Báo cáo sinh học: " Modeling relationships between calving traits: a comparison between standard and recursive mixed models" ppt
Báo cáo sinh học: " Modeling relationships between calving traits: a comparison between standard and recursive mixed models" ppt
... 42:1http://www.gsejournal.org/content/42/1/1Page 5 of 9RESEARC H Open Access Modeling relationships between calving traits: a comparison between standard and recursive mixed modelsEvangelina López de Maturana1,2*, ... (co)variance between sire effects of GL and CD,hGL2 and eGL2are the herd-year and residual variancesfor GL, and hhGL CD and eeGL CDare the herd-year and residual covariances between ... environmentalcorrelations.Additional file 1: Table S1 - Posterior means (standard deviations) ofdirect (d) and maternal (m) heritabilities of calving traits. Table S2 -Posterior means (standard deviations)...
- 9
- 388
- 0
Báo cáo sinh học: "Bayesian analysis of calving ease and birth weights" potx
... estimated genetic and residual covariance matrices.These covariance matrices are traditionally estimated using analytical approximations. A Gibbs sampler for making full Bayesian ... size in Danish Landrace pigs: a Bayesian analysis. Theor ApplGenet 88, 220-230Wang CS, Quaas RL, Pollak EJ (1995) Bayesian analysis of calving ease scores and birth weights. ... sampling. Jensen (1994) analyzed simulated data ofone binary trait and one continuous trait via Gibbs sampling under a Bayesianframework. Wang et al (1995) gave a Bayesian...
- 27
- 333
- 0
Báo cáo sinh học: "An image processing approach to computing distances between RNA secondary structures dot plots" ppsx
... GUCUGAAGCUCAAUGAUCUC- CUAGACCUCUUUAGUGGAAC-CAAUUAAACUCGUGUACGGAU GGCCGCGGACUGAAUAUCUAG4 .(((((((((((( (( )) ))))))))).))) 43 CUCGUGAAUAUAACACUCAAG- AUUCAAAAAAAACAAAUCAAA-GACCGAAAUUUAUGUUUAGUGA AAAAGAAAAGUUUUUUUUAGAA5 ... original RNAinverse [6]Output sequence of modified RNAinverse [6]1 ((( ((( ((( ))) ((( ))) ))) ))) 45 ACCGCCAGACAGGGCCAAGCCA- UCCAAAUUCAUAGUAUAAUACA-CAUCCUAAGGAAAAGAAAAAGGA CAUCCUAAGGAAAAGAAAAAGGA2 ... AUUCAAAAAAAACAAAUCAAA-GACCGAAAUUUAUGUUUAGUGA AAAAGAAAAGUUUUUUUUAGAA5 (((( ((( (( ((((( ))))) )) ))))))) 46 GGUUCAGUUCAUUGCUCAUACUU- UAUGUUAUCAAUUGUUGGCAUGC-AACGGUAUUCUCGUACGACAACC AGUCAUGCAUUCAUAGGGUCGUGThis table displays the results...
- 19
- 245
- 0
Báo cáo sinh học: "Modeling genetic imprinting effects of DNA sequences with multilocus polymorphism data" ppsx
... proposed a statisticalmethod for detecting risk haplotypes for a complex traitwith a random sample drawn from a natural population.Liu et al.'s approach can be used to characterize DNAsequence ... advice and help. RW conceived the model and wrote the paper.AB provided final modifications to the paper. All authorshave read and approved the final manuscript.Additional materialAcknowledgementsThis ... imprinted genes and theiractions and interactions are studied. Genetic mappingwith molecular markers and linkage maps has been usedto map quantitative trait loci (QTLs) that show parent-of-origin...
- 11
- 339
- 0
Báo cáo sinh học: "Genetic relationships among twelve Chinese indigenous goat populations based on microsatellite analysisGenetic relationships among twelve Chinese indigenous goat populations based on microsatellite analysis" pps
... Tibetan goat, Small-xianggoat), block II(Taihang goat,Neimonggol goat,Liaoning goat)andblock III(Nanjiang Browngoat, Chuandong White goat, Black goat, Wu goat). The Matou goat popula-tion was ... goat had a large numberof individuals and broad distributing area. In contrast, the Small-xiang goatexisted in a remote area with a small population size and there was less geneexchange between ... goat. The Wu goathad a common geographical location and a similar morphological appearanceto that of the Chuandong White goat. In general, the four populations hadcloser genetic distances and...
- 16
- 272
- 0
Báo cáo sinh học: "Evolutionary relationships of Red Jungle Fowl and chicken breeds" doc
... populations of intra-island Fijian and Western Samoan fowls had greater band sharing values and lesser geneticdistances, i.e. they were close to each other. In contrast, the inter-island bandsharing ... 10.1051/gse:2003031Original articleEvolutionary relationships of Red Jungle Fowl and chicken breedsIrina G. MOISEYEVA a , Michael N. ROMANOVb∗,Andrey A. NIKIF O ROV a , Antonina A. SEVASTYANOVAc,Serafima ... Comb; MA = Malay; MG = Moscow Game; MI= Minorca; RJF = Red Jungle Fowl; RK = Russian Korolyok Bantam; and RW =Russian White.(Chabo, or Japanese Bantam, and Russian Korolyok, a Bantam of Russianorigin);...
- 21
- 204
- 0
Báo cáo sinh học: " Genetic relationships in Spanish dog breeds. I. The analysis of morphological characters" potx
... charactersJ JordanaJ Piedrafita, A SanchezUniversitat Aut6noma de Barcelona, Unitat de Genètica i Millora Animal,Departament de Patologia i de Producci6 Animals, Facultat ... Gran Enciclopedia Canina. Planeta - DeAgostini, BarcelonaGuasp A (1982) Pastor Mallorqufn o Ca de Bestiar. In: I Sym Nac Razas CaninasEspafiolas, Cordoba 19-21 marzo ... Nac Razas Caninas Espafiolas, Cordoba, 19-21 marzo 1982 (Departamentode Produccion Animal de la Facultad de Veterinaria de la Universidad de C6rdobay Aula de Veterinaria...
- 20
- 284
- 0
Báo cáo sinh học: " Genetic relationships in Spanish dog breeds. II. The analysis of biochemical polymorphism" pps
... gen6tico - taxon6mica en siete ecotipos de la Rasa Aragonesa. IVJornadas Cientificas, de la Sociedad Espanola de Ovinotecnia, Zaragoza, 7-9 June1979, Zaragoza, 63-76Villemont ... means of a hierarchical analysis taking the breeds asOTUs (Swofford and Selander, 1981), a matrix of distances among ancestraltrunks is computed, obtaining an average ... Sdnchez A (1991) Variabilidad gen6tica en diez razascaninas espanolas. Arch Zootec 40, 147, 115-128Jordana J, Piedrafita J, SAnchez A (1992) Genetic relationships in Spanish...
- 19
- 249
- 0
báo cáo sinh học:" Final call for papers: "Towards a scaling-up of training and education for health workers" potx
... that could be considered are:• What ongoing efforts to increase graduate level primarycare training have been established in developing coun-tries. What has been their impact and what have ... sociallyaccountable?• What is the status of existing collaborations between developing countries aiming to improve health workereducation?• How have modifications in healthcare management hadan ... willtraining by protocol differ from, and complement, tradi-tional community health worker training?• How can the health professional training be betteraligned with local health needs and be...
- 2
- 370
- 0
báo cáo sinh học:" Conflict among Iranian hospital nurses: a qualitative study" ppt
... Negarandeh R, Oskouie E, Ahmadi F, Nikravesh M, Hallberg IR:Patient advocacy: barriers and facilitators. BMC Nursing 2006,5:3.32. Dehghan Nayeri N, Nazari A, Salsali M, Ahmadi F, Adib Hajbaghery ... Dehghan Nayeri and Reza Negarandeh*Address: School of Nursing and Midwifery, Tehran University of Medical Sciences, Tehran, IranEmail: Nahid Dehghan Nayeri - nahid.nayeri@gmail.com; Reza Negarandeh* ... families and staff."All the companions of the patient demand more carefor their patients and when they are told about thelacks, shortages and inadequacies of facilities they turn a deaf ear...
- 8
- 354
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP