Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx
Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx
... AccessResearchThe short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trialRobert L Findling*1, Maria ... overallTable 3: Change in baseline to endpoint in depressive symptomatology and psychosocial functioningMeasure characteristicBaseline Fluoxetine a EndpointChange Baseline Placebob EndpointChange ... symptomatol-ogy in this patient population. Another hypothesis wasthat treatment with fluoxetine would be associated with a favorable safety and tolerability profile. As the improve-ment of...
- 13
- 380
- 0
Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc
... Noevidence for HTLV infection among leukaemia patients in Germany. Lancet 1983, 2:1495.27. Miyoshi I, Hatakeyama N, Murakami K, Sawada T, Takimoto Y: Sézary syndrome in an HTLV-I-seronegative, genome-posi-tive ... assistance. They are indebted to Prof. Harald Stein (Head of the Dept. of Pathology, Charité Campus Benjamin Franklin) for giving them access to lymphoma DNA samples. TB and SS were supported by the ... Isola-tion of a new type C retrovirus (HTLV) in primary uncul-tured cells of a patient with Sézary T-cell leukaemia. Nature1981, 294:268-271.5. Kalyanaraman VS, Sarngadharan MG, Robert-Guroff...
- 7
- 428
- 0
Báo cáo y học: "The triterpenoid CDDO inhibits expression of matrix metalloproteinase-1, matrix metalloproteinase-13 and Bcl-3 in primary human chondrocytes" ppt
... expression of MMP-1 and MMP-13 in SW-1353 cells and in two primary cultures: human primarychondrocytes and OA synovial fibroblasts. We haveshown in a quantitative manner that in all three cell types,MMP-1 ... pro-inflammatory cytokines in RA,anti-tumor necrosis factor-α (anti-TNF-α) and anti-inter-leukin 1 (anti-IL-1) therapies can reduce inflammation and retard the progression of disease as assessed radiograph-ically ... that in both of these diseases pro-inflam-matory cytokines are present, resulting in an inflammatorystate as well as cartilage degradation [14]. As further evi-dence for the role of pro-inflammatory...
- 7
- 348
- 0
Báo cáo y học: " Soluble receptor for advanced glycation end products in COPD: relationship with emphysema and chronic cor pulmonale: a case-control study" potx
... data suggest compartmentalization of RAGEligands in the airway lumen in patients with obstructivelung diseases, and may explain why we did not find anysignificant increase in the circulating ... lackingtransmembrane and cytosolic domains, acts as a decoyreceptor for R AGE ligands in the extracellular compart-ment, and is believed to afford protection againstinflammation and cell injury ... strongly asso-ciated with the impairment of lung diffusing capacity, and the severity of structural emphysema as seen on CT.The association of sRAGE with emphysema remainedstatistically significant...
- 9
- 417
- 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx
... thatdephosphorylation and/ or catalytic turnover of EIIGlc,rather than binding of Glc, enhanced the reactivity of Cys421. As Cys421 is the only invariant cysteine in homologous transporters and also the only essential ... examples of the inactivation curvesobtained with 1a, iodoacetamide and bromoacetic acid aregiven in Fig. 3, and the results obtained with all compoundsare listed in Table 3. Rates of inactivation ... dehydrogenase assay.Table 1. Kinetic constants of EIIGlc and EIIManfor analogues of D-glucose. Phosphorylation was measured at 30 °CwiththeL-lactate dehydro-genase-coupled assay. Kinetic...
- 12
- 720
- 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGCHJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGAHJ1 AGAAGCTCCATGTAGCAAGGCTAGHJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAGASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATTDU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTADU2 TAGGCAGACTGACCCGGGAGCTGCTCGTACHJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTTHJ6 ... consider-able insights into the molecular pathways of DNA repair.Prominent amongst these pathways is recombination.Genetic recombination occurs via breakage and reunion of DNA chains and generally...
- 10
- 672
- 0
Báo cáo y học: "The 3rd International Meeting on Gene Therapy in Rheumatology and Orthopaedics" pot
... salivary glands can be accomplished in a relatively noninvasive manner. Bruce Baum (NationalInstitutes of Health, Bethesda, MA, USA) described thesuppression of disease in a murine model of ... transferapproaches, and the potential patient population is very large.Because most conditions are debilitating rather than lethal, safety is a dominating issue that determines the types of vectors ... shown in animal models of pain [4]. Thisis clearly of relevance to rheumatology and orthopaedics, in which intransigent pain is a frequent dominant symptom.Inder Verma (the Salk Institute, La Jolla,...
- 6
- 289
- 0
Báo cáo y học: "The CRIT framework for identifying cross patterns in systems biology and application to chemogenomics" ppt
... case in terms of the range of available system-wide datasets; however,yeast is a harbinger for other systems. Technological and computational advances are leading to a dramaticincrease in system-wide ... patterns in systems biology and application tochemogenomicsTara A Gianoulis1,2, Ashish Agarwal3,4, Michael Snyder5 and Mark B Gerstein3,4,6*AbstractBiological data is often tabular but finding ... discern what types of proteins are mostaffected by aromatic drugs. Similarly, both canonical cor-relation analysis (CCA) and biclustering can define rela-tionships a mongst data sets that sha re...
- 12
- 391
- 0
Báo cáo y học: " Rationale for one stage exchange of infected hip replacement using uncemented implants and antibiotic impregnated bone graft"
... vancomycin alone and in combination with tigecycline and rifampicin against Staphylo-coccus aureus. J Antimicrob Chemother 2009;63(3):485-8. 40. Gristina AG, Jennings RA, Naylor PT, Myrvik ... side a stem with rectangular diameter may offer several advantages: fixation relies mainly on contact of its medial and lateral edges with original bone while the anterior and posterior aspect ... Klekamp J, Dawson JM, Haas DW, DeBoer D, Christie M. The use of vanco-mycin and tobramycin in acrylic bone cement: biomechanical effects and elu-tion kinetics for use in joint arthroplasty. J Arthroplasty...
- 6
- 466
- 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... experimentally. In analogy with the values calculated in enzymaticexperiments, an increase of % 0.5 pK units of theHis57 in DK9 mutant was also calculated analyzing theNAPAP data set (Table 1C). In ... protonation state of catalytic residues of theenzyme.Abbreviations a- NAPAP, N -a- (2-naphthylsulfonyl-glycyl)-4-amidinophenylalanine-piperidine; Bis-Tris, (2-hydroxyethyl)iminotris(hydroxymethyl)methane;CHES, ... study, the pH dependence of thecatalytic activity and binding of the low-molecular mass inhibitor N -a- (2-naphthylsulfonyl-glycyl)-4-amidinophenylalanine-piperidine (a- NAPAP) tothe wild-type...
- 11
- 553
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo giáo dục thể chất trường tiểu họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP