Báo cáo y học: "Anatomic and functional leg-length inequality: A review and recommendation for clinical decision-making Part I, anatomic leg-length inequality: prevalence, magnitude, effects and clinical significance" pdf
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
... Tabatowski K, Elson CE, Johnston WW: Silicone lymphadeno-pathy in a patient with mammary prosthesis. Fine needleaspiration cytology, histology and analytical electron micro-scopy. Acta Cytol ... Cases DatabaseAny patient, any case, can teach ussomethingwww.casesnetwork.comAbbreviationsARDS, adult respiratory distress syndrome; FNA, fineneedle aspiration; FNAC, fine needle aspiration ... clinical examination and initial ultrasound investigation showed both implants to be intact. However,mammography and magnetic resonance imaging of both breasts revealed both intracapsular and extracapsular...
- 5
- 264
- 0
Báo cáo y học: " Andrew Kaplan (1959–2006): remembering a friend and a colleague" ppsx
... peer review as a reviewer for the Journal of Virology, alwaysgrateful for his thoughtful reviews. Over the last year hewas one of the most active reviewers for JV. Andy was oneof a very small ... fundamental questions about the viralprotease.In the last few years Andy's intellectual breadth becamefully apparent as did his role as a mentor and collabora-tor. He made contributions ... made a point ofattending the Cold Spring Harbor Retrovirus Meeting heldeach May. Presentations at this meeting have been a rite-of-passage for young retrovirologists for thirty years and Andy...
- 2
- 136
- 0
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx
... perform the necessary distal coronaryanastomoses and subsequently the proximal by partialclamping of the aorta (for the cases with more than onegraft). After completion of the proximal anastomosesthe ... Determinants and prognosis of myocardial damage aftercoronary artery bypass grafting. Ann Thorac Surg 2005, 79:837-45.9. Weisel R: Myocardial protection during for mechanical complications ofmyocardial ... interventricular septum after myo-cardial infarction constitutes a severe mechanical com-plication of the coronary artery disease with very highsurgical mortality (19-50%) and morbidity [1,2]. Manyfactors...
- 4
- 369
- 0
Báo cáo y học: "Measles vaccination in humanitarian emergencies: a review of recent practice" potx
... Both appeals are coordinated by OCHA (UnitedNationsOfficefortheCoordination of HumanitarianAffairs) with parti cipation from NGOs and UN agenci es.Although the CAP/Flash appeal may not have ... vitamin A deficiency.Many deaths attributed to diarrheal dis ease and pneumo-nia may also be associated with measles. In the past,measles case-fatality ratios i n children in humanitarianemergencies ... measlesvaccination campaign for children aged 6 months-12 years–Afghanistan,2002. Morb Mortal Wkly Rep 2003, 52(16):363-6.18. Vijayaraghavan M, Lievano F, Cairns L, Wolfson L, Nandy R, Ansari...
- 11
- 323
- 0
Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx
... separated fromnonacetylated chloramphenicol by ascending thin-layerchromatography [18]. Chromatograms were examined and quantified with a Fuji image analyzer BA100.HIV-1-LTR DNA binding assayHIV-1-LTR ... & Ames, B.N. (1987) Normal oxidativedamage to mitochondrial and nuclear DNA is extensive. Proc.Natl Acad. Sci. USA 85, 6465–6467.25. Hayakawa, M., Ogawa, T., Sugiyama, S., Tanaka, M. & ... Saitama, JapanMitochondrial functional and structural impairment and generation of oxidative stress have been implicated in aging,various diseases and chemotherapies. This study analyzedazidothymidine...
- 7
- 378
- 0
Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx
... study was 39.6 years (standard deviation 11.3 years).The mean age at onset of psoriasis was 26.8 years (standarddeviation 12.1 years) and the mean age at onset of PsA was33.0 years (standard ... Newfoundland PsA patients, 53% were male and theirmean age at onset of the study was 49.7 years. The mean ageat onset of psoriasis was 29.3 years (standard deviation 14.2years) and the mean age at ... onset of PsA was 38.1 years(standard deviation 11.0 years). Of the PsA patients, 60% hadpolyarticular disease, 32% had oligoarticular disease and 7%had an isolated spondyloarthropathy. For the...
- 3
- 324
- 0
Báo cáo y học: "valuation of endoscopic vein extraction on structural and functional viability of saphenous vein endothelium" potx
... hasconcluded that EVH was associated with lower SV graftpatency at 1-year and higher rate of perioperative myocar-dial infarction and need for revascularization within 1-yearcompared to OSVH [27]. Although ... Boston, MA. Tran-sit time and temperature (20 ± 2.2 hours; 7 ± 2.3°C;respectively) were recorded in the laboratory.Structural and Functional AssaysCell Viability AssayStructural and functional ... period. We havepreviouslyshownthatGALA surgical conduit preservation solution, used inour hospital for CABG and peripheral vascular surgery,maintains the structural and functional viability of theblood...
- 9
- 276
- 0
Báo cáo y học: "Cleavage of functional IL-2 receptor alpha chain (CD25) from murine corneal and conjunctival epithelia by MMP-9" pptx
... measured by an immunobead assay.Results: CD25 and CD122 were abundantly expressed in cornea (all layers) and conjunctiva epithelia (apical and subapical layers) in nonstressed control mice. After ... life and death of lymphocytes: implications for immunotherapy. Immunity 2001, 14:105-110.3. Miyazaki T, Liu ZJ, Kawahara A, Minami Y, Yamada K, Tsujimoto Y, Barsoumian EL, Permutter RM, Taniguchi ... (AmershamBiosciences, Little Chalfort Buckinghamshire, England) and the images were acquired and analyzed by a KodakImage Station 2000R (Eastman-Kodak, New Haven, CT).Bands intensities were measured...
- 11
- 241
- 0
Báo cáo y học: "Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element" ppt
... 5′-agcttttccaaaaaaagctcatcggaactgacaatctcttgaattgtcagttcc-gatgagctg-3′; PRE 1329 5′-gatccgctgacaattctgtcgtcctttcaa-gagaaggacgacagaattgtcagttttttggaaa-3′ ; AtPRE1329 5′-agcttttccaaaaaactgacaattctgtcgtccttctcttgaaaggacgaca-gaattgtcagcg-3′. ... and various amount of pSiRNA expression plasmids as indicated, pUC18 was used tomake up the total DNA to 1 μg. Cells were harvested at day 1, day 2 and day 3 post-transfection and analyzed for ... amplificationoftheSAsequence(forward:SAF_XhoI5′-gaattcctcga-gagaccaatagaaactgggc-3′, reverse: SAR_EcoRV 5′-gaattc-gatatccctgtggagagaaaggcaaagtg-3′).Amplification of the deletion series of the PREThree pairs of primers...
- 10
- 372
- 0
Báo cáo y học: " Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission" pdf
... GTACAG-TATTAGTAGGACCTACACCTGTC, 2470 to 2498, sense) and RT2 (5'AAAATCACTAGCCATTGCTCTCCAATTAC,4307 to 4279, antisense) and then with nested primersRT3 (5'TGGAAGAAATCTGTTGACTCAGATTGG, ... acts asan RNA-dependant DNA polymerase, a DNA-dependantDNA polymerase and has RNase H activity associatedwith the C-terminus [15,16], whereas the p51 subunitlacks the C-terminus RNase H activity, ... Wisconsin package10.1 of GCG. The minimum, median and maximumnucleotide and amino acid distances for each patient and linked patient pairs were calculated from these data (Table2). To analyze the...
- 17
- 252
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ