Báo cáo y học: "Cardiac arrest following a glucose 30% bolus: what happened" pps

... hyponatremia nor hypocalcemia, both of whichLetterCardiac arrest following a glucose 30% bolus: what happened?Philippe Goutorbe1, Nadia Kenane1, Julien Bordes1, Christophe Jego2, Ambroise ... cardiac rhythm had beennormal before the glucose bolus was given, but sinus arrest with junctional or idioventricular escape rhythm developed atthe end of bolus administration, immediately ... in10 ml, at 17 mEq/hour) via the proximal lumen.One hour later hypoglycemia was detected, and 20 ml of 30% glucose was given intravenously. At the end of theinjection, ventricular fibrillation...

Báo cáo y học: "Cardiac arrest provoked by itraconazole and amiodarone interaction: a case report" ppt

... 5:333http://www.jmedicalcasereports.com/content/5/1/333Page 3 of 5CASE REP O R T Open AccessCardiac arrest provoked by itraconazole andamiodarone interaction: a case reportAngeliki M Tsimogianni*, Ilias Andrianakis, Alex Betrosian and Emmanouil ... case reported o f cardiac arrest due to inte raction ofitraconazole and amiodarone.Case report A 65-year-old Caucasian man with history o f hyperten-sion was admitted to our neurology department ... shock and his antifungaltreatment was changed to caspofungin. When sensitivity test results became available, antifungal treatment wasdown-staged to itraconazole and immediately after drug administration...

Báo cáo y học: "Cardiac Reoperation in a patient who previously underwent omentoplasty for postoperative mediastinitis: a case rep" ppt

... surgicaltrauma in patients who are already very sick. On thecontrary, the risk of potential peritoneal contaminationseems to be negligible. Laparotomy may lead to post-operative pain that may ... Anaesthesiology and Reanimation, MedicanaHospitals Camlica, Istanbul, Turkey.3Department of Pediatric Cardiology, Dr.Siyami Ersek Thoracic and Cardiovascular Surgery Center, Istanbul, Turkey.Authors’ ... Journal of Cardiothoracic Surgery 2011, 6:35http://www.cardiothoracicsurgery.org/content/6/1/35Page 4 of 5after isolated coronary artery bypass grafting: early and late mortality,morbidity, and...

Báo cáo y học: "Spinal myoclonus following a peripheral nerve injury: a case report" pps

... Levatiracetam were tried in a few cases. In our patient, various medical treatments wereapplied (Clonazepam 6 mg/day, Carbamazepine 800 mg/day, Na valproate 1000 mg/day, Piracetam 4.8 g/day) butno ... it wasnot stimulus-sensitive.As a result of clinical, laboratory, radiological and electro-physiological evaluations, the patient was diagnosed ashaving a non-proprioceptive spinal myoclonus. ... themanuscript. GE Carried out the clinical examinations andparticipated in conception and design of the data. MKCarried out the electrophysiological evaluations and par-ticipated as a supervisior....

Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps

... dopamine agonists for Par-kinson's disease. N Engl J Med 2007, 356:39-46.7. Yamamoto M, Uesugi T, Nakayama T: Dopamine agonists andcardiac valvulopathy in Parkinson's disease: a case-controlstudy. ... Patras, Greece and 3Department of Anaesthesiology and Critical Care Medicine, University of Patras, School of Medicine. Patras, GreeceEmail: Efstratios E Apostolakis - stratisapostolakis@yahoo.gr; ... Fokaeas - baikoussisn@yahoo.com; Menelaos Karanikolas - kmenelaos@yahoo.com* Corresponding author AbstractRetroperitoneal fibrosis is best described as a chronic inflammatory process which may...

Báo cáo y học: "Cardiac arrest - has the time of MRI come" ppt

... share some limita tions.  ey all included a limited number of patients. Due to the rapid time-dependant variations of ADC, MRI can only be performed early (2 to 5 days) after the cardiac arrest, ... thresholds correlated with clinical outcome with a better sensitivity than clinical examination. A study by Wu and colleagues [3] basically combined these two approaches and found similar results.While ... quantitative infor-mation and images that are useful for explaining the situation to the patient’s family. Wijman and colleagues [2] have shown that brain volume with ADC values below certain...

Báo cáo y học: " Roles of XB130, a novel adaptor protein, in cancer" pps

... cell cycle and survival of cancer. XB130 specifically binds p8 5a subunit of PI3K, which subsequently activate Akt.Akt plays an essential role in cell proliferation and survival.Shiozaki and Liu ... transfected thyroid cancer cells. Among them, 57 genes arerelated to cell proliferation or survival, including many transcription regulators. Pathway analysis showed that the topranked disease related ... approximately 130 kDa [13]. As anadaptor protein, the overall structure of XB130 sharessimilarity with AFAP, thus it is also known as actin fila-ment associated protein 1-like 2 (AFAP1L2)....

Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx

... (CTGCCCT-GTATCATCTGAACC) and T3R3 4a (CTCCCCTGAC ATTCAACGC) amplifying the gag gene of the viral genomewhereas for the murine hybrid retrovirus primers T3R27s2(CAGGGAGAACATGGTAATAGGA) and T3R2 7a2 (ACGACCTCTCCAAAGTATCCA) ... SMRV-805 7a (GTAGGAGGGGAACCGGCTAC) for SMRV andT3R03s (AGGGGATTTATTGGATACACG), T3R3 2a (CATCGTGACCTGGGAAGC) for the murine retrovirus.PCR products were sequenced directly by primer walkingand resulting ... DNA-Ligase and T4 DNA-Ligase buffer (New England Biolabs) and 20 pmol adaptercomposed by the hybridized oligonucleotides NBam24(AGGCAACTGTGCTATCCGAGGGAG) and NCsp11(TACTCCCTCGG) for 1 h at...

Báo cáo y học: " Chinese medicines as a resource for liver fibrosis treatment" ppsx

... fibrotic ratsRhizoma Zingiberis, Ramulus Cinnmomi, Radix Aconiti Lateralis preparata, Radix Astragali, Radix Bupleuri, Fructus Aurantii, Rhizoma Atractylodis macrocephalae, Radix GlycyrrhizaeFuzheng ... diureticeffects of Wakan-yaku prescription on normal rats and vari-ous pathological models. Wakan Iyakugaku Zasshi 1996,13:484-485.98. Feng Y, Nagamatu T, Suzuki Y, Kawata T, Feng YG, Kobayashi S,Koike ... Pharmacobiology and Therapeutics, Faculty of Pharmacy, Meijo University, 150 Yagotoyama, Tenpakuku, Nagoya 468-8503, JapanEmail: Yibin Feng - yfeng@hku.hk; Kwok-Fan Cheung - kwokfan@hkusua.hku.hk;...

Báo cáo y học: "Imaging of hibernomas: A retrospective study on twelve cases" pps

... of various sizes (black arrows).Papathanassiou et al. Clinical Sarcoma Research 2011, 1:3http://www.clinicalsarcomaresearch.com/content/1/1/3Page 9 of 11that are usually painless and relative ... (asterisk).Figure 2 Axial contrast-enhanced CT scan: Delineation ofvessels (black arrows and arrowheads) is apparent onenhanced images.Papathanassiou et al. Clinical Sarcoma Research 2011, 1:3http://www.clinicalsarcomaresearch.com/content/1/1/3Page ... subcutaneous mass of the lateral aspect ofthe left buttock that is clearly hypointense to subcutaneousfat.Papathanassiou et al. Clinical Sarcoma Research 2011, 1:3http://www.clinicalsarcomaresearch.com/content/1/1/3Page...

Xem thêm

Từ khóa: báo cáo y học báo cáo y học cổ truyền mẫu báo cáo y học cổ truyền bao cao y hoc colchicin phan ban luan trong bao cao y hoc co truyen báo cáo khoa học y học báo cáo y tế học đường mẫu báo cáo y tế học đường báo cáo y tế học đường cuối năm báo cáo y tế học đường năm 2012 báo cáo y tế học đường trường mầm non biểu mẫu báo cáo y tế trường học báo cáo y tế học đường trường tiểu học báo cáo y tế trường tiểu học báo cáo y tế trường học năm 2012 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ