Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop " doc

Báo cáo y học: "The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop." doc

... Retrovirology 2010, 7:113http://www.retrovirology.com/content/7/1/113Page 6 of 10REVIE W Open AccessThe xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop Jonathan ... al.: The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop. Retrovirology 2010 7:113.Submit your next manuscript to BioMed Centraland take full ... evidence for xenotropic murine leukemia virus-related virus(XMRV) in German prostate cancer patients.Retrovirology 2009, 6:92.13. Hong P, Li J, Li Y: Failure to detect Xenotropic murine leukaemia...

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

... type 1 322:TCCGCCGAATGGCCAACTTTCAATGTAGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCCCTCAGGTTAAGTCTAGAGTGTTTTGTCATGGTCCCCACGG 428CFS type 2 322:TCCGCCGAATGGCCAACTTTCAATGTAGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCCCTCAGGTTAAGTCTAGAGTGTTTTGTCATGGTCCCCACGG ... 321:TCCGCCGAATGGCCAACTTTCAATGTGGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCTCTCAGGTTAAGTCTAGAGTGTTTTGTCCTGGTCCCCACGG 427PmERV Chr 7 321:TCCGCTGAATGGCCAACTTTCAATGTGGGATGGCCTCAGGATGGTACTTTCAATTTAAGTATTATCTCTCAGGTTAAGTCTAGAGTGTTTTGTCCTGGTCCCCACGG ... 340********************************************************************Contaminant 341:ATGGGGCTGTGAGACCACTGGACAGGCATACTGGAAGCCATCATCATCATGGGACCTAATTTCCCTTA 408PmERV Chr 7 341:ATGGGGCTGTGAGACCACTGGACAGGCATACTGGAAGCCATCATCATCATGGGACCTAATTTCCCTTA 408********************************************************************p-env1r********************************************************************Contaminant...

Báo cáo y học: "The active metabolite of leflunomide, A77 1726, interferes with dendritic cell function" doc

... cellsDCs are typically characterized by their ability to produce largeamounts of predominantly T-cell modulatory cytokines [26].Analyzing cytokine production of cells that were differentiatedand ... during maturation of immature DCs leads to a differentially affected phenotypeTreatment with LEF-M during maturation of immature DCs leads to a differentially affected phenotype. Monocytes were ... immature and are function-ally equipped to capture and process antigens. DCs are acti-vated by pathogen-associated microbial patterns such aslipopolysaccharide (LPS) or by proinflammatory cytokinessuch...

Báo cáo y học: "The p38 mitogen-activated protein kinase signaling cascade in CD4 T cells" docx

... theinduction of IL-4 by phorbol 12-myristate 13-acetate andionomycin or of IL-5 and IL-13 by phorbol 12-myristate 13-acetate and dibutyryl cAMP was partly abrogated bySB203580 [59,66]. In murine splenic ... vertebrates canalso be phosphorylated at a serine residue [77]. Stimulationby IL-12, for example, induces STAT4 phosphorylation at both tyrosine and serine residues. Serine phosphorylation isrequired ... by which p38 MAPK may modulatecytokine gene transcription in T cells may be through theregulation of gene accessibility. Indeed, histone phosphory-lation, as well as acetylation or methylation,...

Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx

... fact that treatments offered by TH arecheap and that they are easier to access, most patientsconfirm ed that they visited TH because their treatmentswere painless and faster. This has a psychological ... impacton the patients [41] as anticipated pain during dentaltreatment causes anxiety. It has been found that patientswith high dental anxiety are likely t o have exaggeratedmemory and prediction ... that these are not scien-tifically proven treatments [13].In the present study the diagnosis of dental pathologywas mostly by visual examination. Other studies inAfrica have reported that...

Báo cáo y học: " The role of tibialis posterior fatigue on foot kinematics during walking Research" doc

... study was to investigate the effect of localised tibialis posterior muscle fatigue on foot kinematics during walking. It was hypothesised that following fatigue, subjects would demonstrate greater ... Correspondence: mbpohl@ucalgary.ca1 Running Injury Clinic, Faculty of Kinesiology, University of Calgary, Calgary, AB, CanadaFull list of author information is available at the end of the articlePohl ... achieve normal foot kinematics. Moreover,since the subjects used in the present investigation hadrelatively normal foot structure, they may have been ableto successfully compensate for the tibialis...

Báo cáo y học: "The effect of tiotropium therapy on markers of elastin degradation in COPD" doc

... before the study. Onepatient with alpha-1 antitrypsin deficiency had neversmoked. Two patients had homozygous-Z phenotypealpha-one antitrypsin deficiency (ATTD). Patients werecategorized as ... andtherefore may be an indication of stimulation of neu-trophils and macrophages by a heightened inflammatorystate of patients with COPD as indicated by increasedinflammatory markers detected in ... been demon-strated in lung parenchyma. Recently, techniques fordetecting and quantifying elastin degradation in body flu-ids have advanced in specificity, sensitivity and accuracyby the use of...

Báo cáo y học: " The role of endothelin-1 in hyperoxia-induced lung injury in mice" docx

... study yield evidenceof the involvement of ET-1 in the lung function changesinduced by hyperoxia. The highly dissociated effects ofoxygen toxicity on the airway and tissue mechanics dem-onstrate ... calculation of thetotal respiratory system resistances at the breathing fre-quency (Rrs = Raw + G/ωα, where ω = 4π at 2 Hz and α =2/π arctan [H/G]) in Fig. 3 may lead to misinterpretationof ... total respiratory system resistance at 2 Hz after iv endothelin-1 administrationFigure 3Temporal changes in the total respiratory system resistance at 2 Hz after iv endothelin-1 administration. *:...

Báo cáo y học: "The Hoover''''s Sign of Pulmonary Disease: Molecular Basis and Clinical Relevance" docx

... of severe airwayobstruction. While readily recognizable at the bedside, it may easily be missed on a cursory physicalexamination. Hoover's sign refers to the inspiratory retraction of ... In amultivariate analysis, severity of dyspnea, the patient'sbody mass index, numbers of exacerbations historicallyand numbers of prescribed drugs were independentlyassociated with the ... spaces thatoccurs with obstructive airway disease. It results from alteration in dynamics of diaphragmaticcontraction due to hyperinflation, resulting in traction on the rib margins by the flatteneddiaphragm....

Báo cáo y học: "The Pediatric Obsessive-Compulsive Disorder Treatment Study II: rationale, design and methods" docx

... types of treatment (inpatient treatment, out-patient treatment, medication, other treatment costs). Theincrease in costs for inpatient treatment for hyperkineticdisorder may be explained by ... adolescentstreated for hyperkinetic disorder decreases dramaticallywith age [41], the great majority of patients on medicationare in the age group < 15 years, with only a very smallnumber ... Attention-deficit hyperactivity disor-der. Lancet 2005, 366:237-248.4. Barkley RA: Major life activity and health outcomes associatedwith attention-deficit/hyperactivity disorder. J Clin Psychiatry2002,...

Xem thêm