Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot
Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot
... Removal of arginine 332allows human TRIM5alpha to bind human immunodeficiency virus capsids and to restrict infection. J Virol 20 06, 80 : 67 38 - 67 44.28. Nakayama EE, Miyoshi H, Nagai Y, Shioda T: A ... Nakayama EE, Yokoyama M, Sato H, Levy JA, Shioda T: A sin-gle amino acid of the human immunodeficiency virus type 2 capsid affects its replication in the presence of cynomolgusmonkey and human ... Technology, and the Ministry of Health, Labour and Welfare, Japan.References1. Shibata R, Sakai H, Kawamura M, Tokunaga K, Adachi A: Early rep-lication block of human immunodeficiency virus type 1 in monkey...
- 11
- 235
- 0
Báo cáo y học: " Collapse-to-emergency medical service cardiopulmonary resuscitation interval and outcomes of out-of-hospital cardiopulmonary arrest: a nationwide observational study" pdf
... orotracheal intubation wasincluded as a sanctioned method of clearing airways byEmergency Life-Saving Technicians (ELSTs) with 262 hours of additional national standard training. Adrena-line administ ... Hiraide A, Nakanishi N, Hayashi Y, Nishiuchi T, Yukioka H, Yoshiya I,Sugimoto H: Age and sex analyses of out -of- hospital cardiac arrest in Osaka, Japan. Resuscitation 2003, 57: 145-152.30. Kajino ... regres-sion analysis for outcome.We obtained permission to analyze the data from theFire and Disaster Management Agency of Ja pan, and theAgency provided an anonymized dataset. This study wasapproved...
- 9
- 338
- 0
Báo cáo y học: "2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema" pdf
... as HAE and should bereplaced as soon as possible with large phase III and IV clinical trials, meta analyses, and using data base registryvalidation of approaches including quality of life and ... Canada.30Department of Medicine, University of Manitoba,Winnipeg, Manitoba, Canada.31University of Auckland, Auckland, NewZealand.32Department of Internal Medicine, University of Cincinnati,Cincinnati, ... Medicine and Paediatrics, University of Calgary, Calgary,Alberta, CanadaBowen et al . Allergy, Asthma & Clinical Immunology 2010, 6: 24http://www.aacijournal.com/content /6/ 1/24ALLERGY, ASTHMA...
- 13
- 718
- 0
Báo cáo y học: "he Alcohol Use Disorders Identification Test (AUDIT): reliability and validity of the Greek version" docx
... what wasnormally expected from you because of drinking?0. 471 9 0. 76 5 7 0. 577 1 0. 76 8 How often during the last year have you needed a first drink in themorning to get yourself going after a heavy ... DiscussionAUDIT has a high level of in ternal consistency and highreliability and validity in relation to clinical diagnosis. Itdetects 97% of patients and with a cut-off point set at 10points has ... heavy drinking session?0.5993 0. 76 0 5 0. 472 4 0 .78 35How often during the last year have you had a feeling of guilt orremorse after drinking?0.55 36 0 .75 83 0.50 76 0 .77 71How often during the last...
- 5
- 457
- 0
Báo cáo y học: "Adalimumab clinical efficacy is associated with rheumatoid factor and anti-cyclic citrullinated peptide antibody titer reduction: a one-year prospective study" potx
... baseline and after 6 and 12 months of adalimu-mab treatment. The sera of the control group of patients withRA were analyzed twice with a 1-year interval.Table 2Clinical characteristics of patients ... receivednon-steroidal anti-inflammatory drugs and/ or analgesics, and 6 received other drugs. Patients were followed clinically at reg-ular intervals by the same physician during this period and in particular ... variation of anti-CCP measurements,plates from the same batch (batch number 470 094) wereused; the inter-assay and intra-assay variabilities were lessthan 9%.Detection of ANAAnti-nuclear autoantibodies...
- 8
- 762
- 0
Báo cáo y học: "ronchogenic cyst associated with pericardial defect: Case report and review of the literature." pptx
... cysts: always easy? Asian Cardiovasc Thorac Ann 2009, 17: 4 67 -71 .31. Lang-Lazdunski L, Pilling J: Videothoracoscopic excision of mediastinaltumors and cyst using the harmonic scalpel. Thorac Cardiovasc ... Ishikawa N, Ogata K: [Case of mediastinal bronchogenic cystassociated with partial pericardial defect and cured by excision.]. KyobuGeka 1 963 , 16: 46- 50.20. Marushkin AV, Troshin AP, Malkin DM, Lelechenko ... Takizawa H, Ishikura H, Kimura S, Yuasa Y, Okitsu H, Sakata A: Giantpulmonary cyst associated with congenital pericardial defect. Gen ThoracCardiovasc Surg 20 07, 55 :65 -8.19. Horiide R, Ishikawa...
- 5
- 399
- 0
Báo cáo y học: "Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line" pptx
... Salzman AL, Szabo C: Peroxynitrite-mediated DNA strand breakage activates poly-adenosine diphosphateribosyl synthetase and causes cellular energy depletion in macrophagesstimulated with bacterial ... A role of poly (ADP-ribose) polymerase in NF-kappaB transcriptional activation. Biol Chem 1999, 380:953-9.38. Kannan P, Yu Y, Wankhade S, Tainsky MA: PolyADP-ribose polymerase is a coactivator ... Simbulan-Rosenthal CM, Steadman JA:Identification of poly(ADP-ribose) polymerase as a transcriptionalcoactivator of the human T-cell leukemia virus type 1 Tax protein. J Virol2000, 74 :2 169 -77 .9. Pavri R, Lewis...
- 9
- 279
- 0
Báo cáo y học: " Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line." pptx
... Veres B, Gallyas F Jr, Varbiro G, et al: Decrease of the inflammatoryresponse and induction of the Akt /protein kinase B pathway by poly-(ADP-ribose) polymerase 1 inhibitor in endotoxin-induced ... results indica te that PARP-1 servesas a repressing factor of the heat shock response by reg-ulating the expression of HSP -70 . Both protein- proteininteraction and catalytic activity of the PARP protein play ... 380:953-9.38. Kannan P, Yu Y, Wankhade S, Tainsky MA: PolyADP-ribose polymerase is a coactivator for AP-2-mediated transcriptional activation. Nucleic Acids Res1999, 27: 866 -74 .39. Nie J, Sakamoto S,...
- 9
- 356
- 0
Báo cáo y học: " Post-transcriptional control by bacteriophage T4: mRNA decay and inhibition of translation initiation" pdf
... regionsbΔGcRB14UUUUAAUUUAUAAAUACCUCCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU-18.9 RB69UCCUAUAAGUAAUAAAUACCUCCUAUAAACGUGGGAGGUAUUAUGAAUAUAUUU- 16. 3 T4, othersUUUAAUUUUAUAAAUACCUUCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU-14 .7 CC31GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU-12.2 ... CC31GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU-12.2 CUUAGGAGGUAUUAUGAAUAAUACCUCCUAUAAAUUUAUAAAACGUGGG A GGU A UU A UG A AAU A CCUCCU A UAAAAUACUUAGGAGGUAUUAUGA A CCUUCUAU A AC A UAUUUUUUAUAAAACUCCU A UCAACUGAUAGGAGGC******* ... protein have the SELEX major variant loop sequence (-CAAC-) in their native, autoregulatory RNA hairpins.Phage RB49 contains -UAAA- in its RNA loop, and var-ious repression and RNA -protein interaction...
- 22
- 383
- 0
Báo cáo y học: "Mannose-binding lectin does not explain the course and outcome of pregnancy in rheumatoid arthritis" pot
... the accuracy of the dataanalysis. FG, MW, YM, AD, MH and RD designed the study. FG, MW and YMwere involved in the acquisition of the data. FG, MW, SW, MH and RDanalyzed the matrix-assisted laser ... desorption/ionization time of flight massspectrometry data and interpreted the data. The manuscr ipt was preparedby FG, MW, SW, YM, AD, MH and RD. FG and SW did the statistical analyses.All authors read and ... [2].It has been shown in vitro that MBL can bind topathogenic agalactosyl IgG [3]. In patients with RA,levels of agalactosyl IgG decline during pregnancy, and hence galactosylation increases simultaneously...
- 7
- 341
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI