Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

... 67Ga-transferrin from the intravascular to the extravascular spaces in the lungs, and it is therefore a measure of pulmonary capillary permeability totransferrin [19 ,20]. The mean PLI from the ... pulmonary infiltrates of unknown origin and in whom HSV -1 was isolated from tracheal aspirate or bronchoalveolar lavagefluid. At a median of 7 days (range 1 11 days) after mechanical ventilatory ... During processing, the 99mTc and 67GaAvailable online http://ccforum.com/content/8/3/R139Research Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill...

Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt

... FG and HK partici-pated in the data analysis and review of the manuscript.YN performed project planning, participated in the dataanalysis and helped to draft the manuscript. All authorsread ... Darai G: Identification and mapping of the UL56 gene transcript of herpes simplex virus type 1. Virus Res 19 91, 19 :11 5 -12 6.32. Koshizuka T, Goshima F, Takakuwa H, Nozawa N, Daikoku T, KoiwaiO, ... 1: 20; BD TransductionLaboratories, Franklin Lakes, NJ), -adaptin γ (clone 88; 1: 100; BD), -adaptin δ (clone 18 ; 1: 50; BD), -EEA1 (clone 14 ; 1: 100; BD), -rab7 (clone Rab7 -11 7; 1: 50; SIGMA),and...

Báo cáo hóa học: " Herpes simplex virus type-1(HSV-1) oncolytic and highly fusogenic mutants carrying the NV1020 genomic deletion effectively inhibit primary and metastatic tumors in mice" pptx

... R7020: A live attenuated recombinant herpes sim-plex virus (HSV) candidate vaccine. In Program and Abstacts of the 32nd Interscience Conference on Antimicrobial Agents and Chemother-apy American ... in drafting the manuscript, VNC participated in the construc-tion and characterization of the viruses, AB was involved in the design and conduction of in vivo studies, ATD par-ticipated in pathological ... miceAnna Israyelyan 1, 2, Vladimir N Chouljenko 1, 2, Abolghasem Baghian 1, 2, Andrew T David 1, 2, Michael T Kearney2 and Konstantin G Kousoulas* 1, 2Address: 1 Division of Biotechnology and...

Báo cáo hóa học: " Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells" pdf

... TAGCAGTCATCCAACAGAATCATReverse AATCTTCTGAGTTGATTATGGGTAATLR4 Forward ACACAGAAGAGCTGGCATGAReverse GGTTGTCGGGGATTTTGTAGTLR9 Forward CTTCCCTGTAGCTGCTGTCCReverse CCTGCACCAGGAGAGACAGIFN-α (1/ 13) ... statistical analyses, and drafted the manuscript. RKM participated in the PCR and protein assays. HK participated in the PCR assays. EB,HSK, MW and TV participated in the design and coordina-tion ... concentration of 1 × 10 6 ml -1 in RPMI 16 40 medium containing 10 % FCS, 1% glutamine and gentamicin and were maintained at 37°C in 5% CO2.RNA extraction, production of cDNA and quantitative real-time...

Báo cáo khoa học: "Herpes simplex virus infection in pregnancy and in neonate: status of art of epidemiology, diagnosis, therapy and preventio" potx

... sexuallytransmitted-disease clinics. J Infect Dis 2002, 18 6 :13 81- 1389.20. Arvaja M, Lehtinen M, Koskela P, Lappalainen M, Paavonen J, VesikariT: Serological evaluation of herpes simplex virus type 1 and type 2 infections ... heals without sequelae whereas the CNSform is lethal in 6% of cases leaving 69% of permanent latesequelae. The disseminated infection takes a lethal course in 31% and has late sequelae in 17 % ... behaviour and bacterial vaginosis can facilitate a woman's risk of infection before pregnancy [1, 18 ,19 ].Regarding pregnant population, there is a high prevalence of genital herpes. Among Italian...

Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot

... 5¢-GGTTGACATATGAGCGAATC ⁄ Mm1028 His.rev 5¢-GAAGCTTCTTATAAAAGCCCC; and Mm 17 72His.for 5 ¢-GGTGATATCATATGGTAGAAGTCG ⁄ Mm 17 72His.rev 5¢-GAAGAAAGCTTTAGAGGATAATCTCG) add-ing flanking NdeI and HindIII ... amplified using primers(Mm 218 4 His.for 5¢-CCAAATACAGGATCCATGGA-ATCTAC and Mm 218 4 His.rev 5¢-GAGAATTCATTT-AATAAAGAAGTCCTAAG) that added flanking BamHI and EcoRI sites and facilitated cloning the ... exclusively in the pres-ence of 1. 0 m NaCl (Fig. 3A, lane 6), whereas in the case of the mutated operators M1 (AAA-GGCTTCC-GGT) and M2 (AAA-GGCTTCC-CCT), the majority of MBP–NrpRI eluted at 250 and...

báo cáo khoa học: " Field transcriptome revealed critical developmental and physiological transitions involved in the expression of growth potential in japonica rice" potx

... participated in the design of the research, and carried out the microarrayanalysis and the statistical analysis and wrote the manuscript. BA performed the microarray analysis and analysis the ... embryo and extracted the total RNA. HT carried out sampling of leaves in 2009 and the microarray analysis. HM and KK performed data analysis and constructed the database. MK performed the data analysis ... 49 :14 17 -14 28. 10 . Yazaki J, Shimatani Z, Hashimoto A, Nagata Y, Fujii F, Kojima K, Suzuki K,Taya T, Tonouchi M, Nelson C, Nakagawa A, Otomo Y, Murakami K,Matsubara K, Kawai J, Carninci P, Hayashizaki...

Báo cáo y học: " Herpes simplex virus UL56 interacts with and regulates the Nedd4-family ubiquitin ligase Itch" pps

... (862aa) contains a Ca2+/lipid binding C2 domain, four WW domains that interact with PY motifs, and a catalytic HECT domain. HSV UL56 (HSV -1, 234aa; HSV-2, 235 aa) contains three PY motifs and ... 11 5:2 517 -2527.29. Nishiyama Y, Yamada Y, Kurachi R, Daikoku T: Construction of a US3 lacZinsertion mutant of herpes simplex virus type 2 and characterization of its phenotype in vitro and in ... Nedd4-family ligases: an amino-terminal C2 domain;four protein- protein interacting WW domains, whichmost commonly recognize PY motifs of binding pro-teins; and a carboxyl terminal catalytic...

Báo cáo khoa học: Plasminogen activator inhibitor type-1 inhibits insulin signaling by competing with avb3 integrin for vitronectin binding pptx

... Lawrence (American Red Cross, Rockville, MD,USA): PAI -1 containing a mutation of Gln123 to Lys (PAI-1K) has a speciﬁc defect in VN binding; PAI -1 containing a mutation of Arg340 to Ala (PAI- 1A) binds ... Blocking ligand occupancy of the alphaVbeta3 integrin inhibits insulin-like growth factor Isignaling in vascular smooth muscle cells. Proc. Natl Acad. Sci.USA 95, 11 217 11 222. 14 . Persad,S.,Attwell,S.,Gray,V.,Mawji,N.,Deng,J.T.,Leung,D., ... demonstration of the interaction between PAI -1 and the insulin signaling,through the ability of PAI -1 to interact with VN/avb3system.Using different mutants of PAI -1, we have demon-strated that the...

Báo cáo hóa học: " Human Immunodeficiency Virus type 1 in seronegative infants born to HIV-1-infected mothers" doc

... was performed usingGAG1-GAG2 (5'TCCACCTATCCCAGTAGGAG3' and 5'GGTCGTTGCCAAAGAGTGAT3') or LTR1-LTR2 primers[7]. An aliquot (5 µL) of first round PCR product was thenused as ... eight infants, and two of them tested positive for HIV DNA at 2 years of age. Nested PCR resulted in the amplification of gag, nef/LTR and Alu-LTR fragments, which demostrated that HIV -1 DNA wasintegrated ... Virology Journal 2006, 3:52 http://www.virologyj.com/content/3 /1/ 52Page 3 of 6(page number not for citation purposes)GAG4 (5'TAAAAGATGGATAATCCTGGG and 5'GCCAAAGAGTGATCTGAGGG3') or...

Xem thêm