0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Demodex gatoi -associated contagious pruritic dermatosis in cats - a report from six households in Finland" pot

Báo cáo khoa học:

Báo cáo khoa học: "Demodex gatoi -associated contagious pruritic dermatosis in cats - a report from six households in Finland" pot

... citation purposes)Acta Veterinaria ScandinavicaOpen AccessCase studyDemodex gatoi -associated contagious pruritic dermatosis in cats - a report from six households in FinlandSeppo AM Saari*1, ... treatment of D. gatoi infes-tation in 10 cats from six households in Finland.Case presentationsThe main historical, clinical and diagnostic findings aresummarized in Table 1, and the treatment protocolstested ... locations in Finland containing 21 cats in total. Intense pruritus was the main clinical sign. Scaling, broken hairs,alopecia and self-inflicted excoriations were also observed.Diagnosis was...
  • 8
  • 267
  • 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

... fi5,16-androstadien-3b-ol) [12], 21-hydroxylation (preg fi21-OHpreg fi 5,16-androstadien-3b-ol) [10,13] and 16–17-dehydrogenation (preg fi 1 7a- OHpreg fi 16-dehydro-preg fi 5,16-androstadien-3b-ol) ... preg,1 7a- OHpreg, and DHEA, used as standards, showedelution peaks at 4.70, 2.30 and 2.50 min, respectively(Fig. 2). In both porcine and human assays using preg as a substrate, an additional peak ... pregnenolone; DHEA,dehydroepiandrosterone; 1 7a- OHpreg, 1 7a- hydroxypregnenolone;androstadienol, 5,16-androstadien-3b-ol; androstenol, 5a- 1 6- androsten- 3a- ol; CAR, constitutive androstane receptor;...
  • 7
  • 612
  • 0
Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

... green-to-redphotoconverting GFP-like proteins have also beenfound as major colorants in the scleractinian coralsM. cavernosa, Scolymia cubensis, Catalaphyllia jardinei,the corallimorpharian Ricordia ... 1125–1133.13 Shagin DA, Barsova EV, Yanushevich YG, FradkovAF, Lukyanov KA, Labas YA, Semenova TN, UgaldeJA, Meyers A, Nunez JM et al. (2004) GFP-like pro-teins as ubiquitous metazoan superfamily: ... theARC ⁄ NHMRC Network FABLS Australia (collaborat-ive grant to AS et al.), and IDP Education Australia(Australia–Europe Scholarship to AL). The authorsacknowledge technical help of Florian...
  • 10
  • 487
  • 0
Báo cáo khoa học

Báo cáo khoa học " KINH TẾ THẾ GIỚI VÀ KHU VỰC CHÂU Á TỪ SAU KHỦNG HOẢNG ĐẾN NAY " potx

... [http://www.baomoi.com/Info/Virus-Hy-Lap-se-lay-lan-den-dau/45/4237840.epi] Vấn đề cải cách hệ thống tài chính đà trở thành một trong những vấn đề đáng quan tâm hàng đầu c a các nớc sau khủng hoảng ... hoảng nợ châu Âu" tại [http://vneconomy.vn/20100518034719193P0C99/trai-phieu-my-hut-hang-nho-khung-hoang-no-chau-au.htm] 6 16 nớc thành viên khu vực Eurozone đều chiếm tới 14% tổng kim ... "Nợ công c a thế giới lên tới hơn 35.000 tỷ USD"; http://www.vietnamplus.vn/Home/No-cong-cua-the-gioi-len-toi-hon-35000-ty-USD/20099/176623.vnplus. 21 Theo ớc tính c a IMF (T.4/2009),...
  • 10
  • 372
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Changes of biomarkers with oral exposure to benzo(a)pyrene, phenanthrene and pyrene in rats" ppt

... 15.6*Chemicals were treated for 30 days via gavages to 9 week old female SD rats. Values are the mean ± SD (n = 3). ALT: alanine aminotransferase,AST: aspartate aminotransferase, ALP: alkaline phosphatase. ... microsomal EROD activity was assayed according to the method of Pohl and Fouts [35].Determination of the biochemical parameters in serum Alanine aminotransferase (ALT), aspirate aminotrans-ferase ... pyrene and the total amount of PAHs in occu-pational and dermal exposure in humans; it is a good in- dicator of mutagenic activity in animal and human hepatic fractions [6,21]. The 3-OH-benzo (a) pyrene...
  • 8
  • 245
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Brachytherapy versus radical hysterectomy after external beam chemoradiation: a non-randomized matched comparison in IB2-IIB cervical cancer patients" ppsx

... Alicia Garcia-Arias1, Myrna Candelaria1, David Cantú2, Lesbia Rivera3, Jaime Coronel1, Blanca Bazan-Perkins1, Vladimir Flores1, Aaron Gonzalez2 and Alfonso Dueñas-González*4Address: ... 2007,197:e 1-6 .6. Candelaria M, Chanona-Vilchis J, Cetina L, Flores-Estrada D, López-Graniel C, González-Enciso A, Cantú D, Poitevin A, Rivera L, Hino-josa J, de la Garza J, Dueñas-Gonzalez A: Prognostic ... quiechc8@hotmail.com; Blanca Bazan-Perkins - bbazan@gmail.com; Vladimir Flores - vflores@hotmail.com; Aaron Gonzalez - agonzalez@incan.edu.mx; Alfonso Dueñas-González* - alfonso_duenasg@yahoo.com*...
  • 8
  • 232
  • 0
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... points to the CYP 6A2 specificsignal, the star indicates unspecific signal observed in all lanes loadedwith bacterial protein. The CYP 6A2 variants have the same apparentmolecularmassasCYP 6A2 fromD. ... Tare`s, Alexandra Brun-Barale, Laury Arthaud, Jean-Marc Brideand Jean-Baptiste Berge´Unite´Mixte de Recherche 1112, Institut National de la Recherche Agronomique, Sophia Antipolis, FranceThree ... and was used for further mutagenesis. Weobtained four new variants: CYP 6A2 vS, CYP 6A2 vV,CYP 6A2 vSV and CYP 6A2 vL using the oligonucleotidesSLR (CAGGACAGCCTGCGCAACGAG), RVR (CAGGACAGGGTGCGCAACGAG),...
  • 8
  • 535
  • 0
Báo cáo khoa học: Endogenous tetrahydroisoquinolines associated with Parkinson’s disease mimic the feedback inhibition of tyrosine hydroxylase by catecholamines doc

Báo cáo khoa học: Endogenous tetrahydroisoquinolines associated with Parkinson’s disease mimic the feedback inhibition of tyrosine hydroxylase by catecholamines doc

... 249–255.11 Minami M, Takahashi T, Maruyama W, Takahashi A, Dostert P, Nagatsu T & Naoi M (1992) Inhibition oftyrosine hydroxylase by R and S enantiomers of salso-linol, 1-methyl-6,7-dihydroxy-1,2,3,4-tetrahydroisoquin-oline. ... molecular docking studies [25,40] and X-raycrystallography [18] indicate that BH4and analoguepterins coordinate close to the active-site iron in TH,forming an aromatic p-stacking interaction ... neurotoxin, (R)-N-methylsalso-linol, increases in Parkinsonian cerebrospinal fluid. AnnNeurol 40, 119–122.2 Maruyama W, Sobue G, Matsubara K, Hashizume Y,Dostert P & Naoi M (1997) A dopaminergic...
  • 13
  • 487
  • 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

... Stigmatellin was purchased from Fluka.Preparation of decylubiquinolTen milligrams of 2,3-dimethoxy-5-methyl-n-decyl-1,4-ben-zoquinone (decylubiquinone), an analogue of ubiquinone(Sigma) was ... glutamate (in yeast or humans) may affect thestructure of the hinge region, resulting in a hindered move-ment and enzyme instability. As suggested previously for a yeast mutant with a +1 alanine ... mitochondrial membranepreparations (data not shown). This could be a result ofthe instability of the mutant enzyme and an increasedsensitivity to degradation during membrane preparation,as discussed...
  • 7
  • 498
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP