0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo sinh học: " A simple, practical and complete O -time Algorithm for RNA folding using the FourRussians Speedup" docx

Báo cáo sinh học:

Báo cáo sinh học: " A simple, practical and complete O -time Algorithm for RNA folding using the FourRussians Speedup" docx

... times rather than the absolute times, and we do not incorporate any addi-tional heuristic ideas or optimizations that might beappropriate for one method but not the other. However,we are aware ... interleavingpreprocessing with computation can lead to a practical and simple O( n3/logn) time RNA folding algorithm. Through further analysis this basic algorithm could beapplied to a variety of ... preprocessing and the computation phasesof the Four-Russians method; rather, those two phasesare interleaved in our solution.In this paper, we give a simple, complete and practical Four-Russians algorit...
  • 8
  • 333
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Frame Synchronization and Frequency Offset Estimation Algorithm for OFDM System and its Analysis" pdf

... Numerator and denominator of Q(d) are Gaussianrandom variables. If the standard deviations of both theserandom variables are much smaller than their mean values,then the mean and the variance of ... detections. We also suggest a method for a threshold selection and the preamble boundarydetection in practical applications. A simple and computationally efficient method for estimating fractional and ... same. Based on the theoreticalvalue of the mean and estimate of the variance, we suggest a threshold for detection of the preamble boundary and evaluating the probability of false and correct...
  • 16
  • 299
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A simple algorithm to estimate genetic variance in an animal threshold model using Bayesian inference" docx

... individual records). There-fore, for comparison purposes the data sets were ana-lyzed using two animal thresh old models (standard and new algorithm) and a sire-dam threshold model.Animal model (Anim)=++XZaewith ... sire-dam mode ls, either as a result of biased estimates of additive genetic variancecomponents (animal model) and/ or as a result of lackingability to account for covariance among observations onthesameindividual(sire -and ... geneticparameters, which would be an advantage of any linear or non-linear animal model.BackgroundAnimal models are the most widely used for the geneticevaluation of Gaussian traits. An animal model...
  • 7
  • 317
  • 0
báo cáo sinh học:

báo cáo sinh học:" A strategy to improve skills in pharmaceutical supply management in East Africa: the regional technical " potx

... Services and otherintergovernmental or nongovernmental organizations. InTanzania, the training has been supported by the NACP,WHO, the National Medical Stores and NGOs. To date, the Uganda RTRC has ... Program(NACP) and the Tanzania Food and Drug Administration(TFDA). In Rwanda, the RTRC is based at the School ofPublic Health and the Department of Pharmacy in the School of Medicine at the National University ... RwandaUganda, Kenya, Tanzania, Rwanda USAID/RPM Plus Program 100 000National HIV/AIDS pharmaceutical supply management training programmesUganda, Tanzania National AIDS-control programmes, WHO, Catholic...
  • 6
  • 366
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Hierarchical convergence of an implicit double-net algorithm for nonexpansive semigroups and variational inequality problems" ppt

... tohttp://www.fixedpointtheoryandapplications.com/authors/instructions/ For information about other SpringerOpen publications go tohttp://www.springeropen.comFixed Point Theory and Applications© 2011 Yao et al. ... double-net algorithm for nonexpansivesemigroups and variational inequality problemsFixed Point Theory and Applications 2011, 2011:101 doi:10.1186/1687-1812-2011-101Yonghong Yao (yaoyonghong@yahoo.cn)Yeol ... (1990)19Hierarchical convergence of an implicitdouble-net algorithm for nonexpansivesemigroups and variational inequality problemsYonghong Yao1, Yeol Je Cho∗2 and Yeong-Cheng Liou31Department of...
  • 20
  • 275
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... 5A) .Characterization of superparamagnetic nanoparticlesTo demonstrate the formation of superparamagneticnanoparticles, the as-prepared Fe3 O 4solution wasdropped on the copper grid coated ... Hybridization probes and type-specific PCRprimersSequenceCapture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGT-3Secondary probe ... design, performed the preparation of nanomaterials and the statistical analysis. All authors read and approved the final manuscript.Competing interests The authors declare that they have no competing...
  • 9
  • 469
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Research Article Existence and Uniqueness of Mild Solution for Fractional Integrodifferential Equations" docx

... 2008.5 J. Liang, R. Nagel, and T J. Xiao, “Approximation theorems for the propagators of higher orderabstract Cauchy problems,” Transactions of the American Mathematical Society, vol. 360, no. 4, ... solution of 1.1 in a Banachspace X: A generates a compact semigroup S· of uniformly bounded linear operators on a Banach space X. The function a · is real valued and locally integrable on 0, ... N’Gu´er´ekata, A Cauchy problem for some fractional abstract di fferential equation with nonlocal conditions,” Nonlinear Analysis: Theory, Methods & Applications, vol. 70, no. 5, pp. 1873–1876,...
  • 10
  • 359
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Research Article Improved Noise Minimum Statistics Estimation Algorithm for Using in a Speech-Passing Noise-Rejecting Headset" pptx

... the SNR of the processed speechare achieved. For good performance, lower values for δ and ξin the lower bands are suggested.6. Performance EvaluationIn order to evaluate the performance of ... histograms from past spectral values below the adaptation threshold over a duration window and choose the maximum noise level to update the noise estimate. The major drawback of their method is that ... with averaging (AFA) is also verified. The main advantages of AFA algorithm could be summarizedas follows: high convergence rate comparable to that of the recursive least squares (RLSs) algorithm...
  • 11
  • 344
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Combined Intensity and Gradient-Based Similarity Criterion for Interindividual SPECT Brain Scan Registration Roger Lundqvist" docx

... summarised as to find the optimalset of transformation parameters which optimises the calcu-lated value of the cost func tion.In our implementation, a global second-order polyno-mial transformation ... a considerable rela-tive loss in resolution in other parts of the histogram. Oneway to overcome this is to perform a histogram equalisa-tion before the corresponding histog ram bins for the ... gradient angle value for each voxel pair,which would lead to the creation of a joint 5D histogram be-fore the mutual information criterion is calculated. However,there would be a major drawback...
  • 9
  • 290
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A comparison of four systems of group mating for avoiding inbreeding" pdf

... 250, a population may be maintained either in one location as one populationor in separate groups (by cyclical mating). In many conservation programmes, the number of animals ... groups and totalpopulation size, the effective population size in circular group mating is larger than...
  • 19
  • 259
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI