báo cáo khoa học: " Cupin: A candidate molecular structure for the Nep1-like protein family" ppt

... [17]Phytophthora megakarya AAX12401 and AAX12403 [18]Phytophthora parasitica AAK19753•• [6]Phytophthora sojae AAM48170•• (PsojNIP), AAM48171 and AAM48172 [19]Pythium aphanidermatum AAD53944•• (PaNie234) ... BiologyOpen AccessResearch article Cupin: A candidate molecular structure for the Nep1-like protein familyAdelmo L Cechin1, Marialva Sinigaglia1, Ney Lemke*2, Sérgio Echeverrigaray3, Odalys ... of the NLPs and in almost all dicot ABPs and is related to the factthat NLPs attack only dicot plants. Also, the way ABPstransmit the information to the cell is intimately related toion channels....

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... Vera Sheinman The Japan Institute for Educational Measurement Inc.3-2-4 Kita-Aoyama, Tokyo, 107-0061 Japanwhittaker,sheinman @jiem.co.jpAbstract The availability of learner corpora, especiallythose ... Computational LinguisticsCreating a manually error-tagged and shallow-parsed learner corpusRyo NagataKonan University8-9-1 Okamoto,Kobe 658-0072 Japanrnagata @ konan-u.ac.jp.Edward Whittaker ... annotation. The more detailedan annotation scheme is, the more information it cancontain and the more difﬁcult identifying errors is,and vice versa. For POS/parsing annotation, there are also a...

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... of data acquisition. Therefore it is of-ten necessary to raise the reward and rely on efﬁcientautomatic validation of the data.We have looked into the answer agreement of the workers as an ... weather to vary so dramatically that it could potentially suppress the more complex forms of life. The heat generated by the Earth/Theia impact, as well as subsequentLunar tides, may have also ... only the real answers, and the NoAs were removed (NoA not included, 3872answers). If an answer was compared with a NoA, the agreement was 0, and if two NoAs were com-pared, the agreement was...

Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc

... is available for each syntactic node. This is guaranteed by the seman- tic rule formalism and by the fact that every lexical item has a semantics associated with it. Table 2 contains average ... the daughter np have the value ynq for its wh feature and that it have the value 1~ (a variable) for its person-number feature. It requires that the daughter sentence have a category value ... overhead associated with adding types to the grammar. The major grammatical category plays a spe- cial role in the typing scheme of Gemini. For each category, Gemini makes a set of declarations...

Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx

... to the 'noise' generated by the fact that we are working with a typesetting tape geared to visual presentation, rather than a database, there are errors in the use of the grammar ... The Mental Representation of Grammatical Relations, The MIT Press, Cambridge, Mass, pp.173-281 Kay, M.(198 4a) 'Functional Unification Grammar: A Formalism for Machine Translation', ... to handle the other problems described above. Rather than apply these programs to the dictionary and create a new restructured file, they are applied on a demand basis, as required by the...

Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx

... 2008)doi:10.1111/j.1742-4658.2008.06537.xPotassium channel tetramerization domain (KCTD) proteins contain a bric -a- brac, tramtrak and broad complex (BTB) domain that is most simi-lar to the tetramerization domain (T1) of voltage-gated ... 403–410.29 Altschul SF, Madden TL, Schaffer AA, Zhang J,Zhang Z, Miller W & Lipman DJ (1997) GappedBLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res ... Program of Apoptosis and Cell Death, Burnham Institute for Medical Research, La Jolla, CA, USA The BTB (bric -a- brac, tramtrak and broad com-plex) ⁄ POZ (poxvirus zinc ﬁnger) domain is a protein protein...

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

... obtained previously. Thus, the sequences of the primers used for 5¢ RACE were: 5¢-GGGCATCACGGAAGAAATAG-3¢ for a reverse transcription and 5¢-GCTCTAGAGCATTCGTCACATCGATACC-3¢ with 5¢-AAGGAATT(dC)14 ... A pair of degenerate primers (abrin 1: 5¢-ACTGAAGGTGCCACTTCACAAAGCTAYAARCARTT-3¢; abrin 3: 5¢-GGTTAAACACTTCCCGTTGGACCTDATNGT-3¢) was cho-sen to represent the possible coding sequences of the ... tocheck the solubility of the recombinant pulchellin A- chain(named rPAC). The clear supernatant was used for the puriﬁcation step.Puriﬁcation of rPAC The supernatant obtained was applied to a 2...

Báo cáo khoa học: AtCYS1, a cystatin from Arabidopsis thaliana, suppresses hypersensitive cell death ppt

... ampliﬁcationof the AtCYS1 cDNA using speciﬁc primers carrying a BamHI site (forward:GGATCCGCGGATCAACAAGCAGGAACA) and a SalI site (reverse:GTCGACTCACGTGGTCTGAGAGCACAC) for directional cloning(restriction ... of the transgene was transient or stable. Aftertransformation, the majority of agrobacteria were removedby extensive washing and the A. thaliana cells were in partanalysed for transgene activity ... againstpathogen attack; however, it is imperative that plantsmaintain the capacity to regulate this process [20]. Here, wedescribe the molecular and biochemical characterization of the A. thaliana...

Báo cáo khoa học: "Towards A Modular Data Model For Multi-Layer Annotated Corpora" docx

... XQuery for XML or SQL for rela-tional databases. But these complicate query for- mulating because they are tailored to query a lowlevel data storage model rather than a high levelannotation data ... parents and to refer to other elementsacross annotation layers.Features have a name and a value. They are al-ways bound to an annotation element and cannotexist on their own. For the time ... operators access base data, but oftenthey take locational arguments or return locationalinformation. When a medial operator is used toaccess textual base data, the result is a string. Aswith...

Báo cáo khoa học: "Towards a Cognitively Plausible Model for Quantification" docx

... same meaning regardless of the context (Forbes, 1989). In such a framework, all natural language quantifiers have their meaning grounded in terms of two logical operators: V (for all), and ... USA and Carelton University, School of Computer Science Ottawa, Ontario, KIS-5B6 CANADA walid@eagle.hr.att.com Abstract The purpose of this paper is to suggest that quantifiers in natural ... natural language, the intensions (meanings) of quantJfiers, however, as well as other functional words, such as sentential connectives, are taken to be constant. That is, such words have the...

Xem thêm