Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

... wasamplified using sense and anti-sense overlapping primers(S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGT-GAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’-TCCAGGCTCCCCCTCGAGCTTGTACAGCTCGTCCAT-3’). In the third ... 7:36http://www.virologyj.com/content/7/1/36Page 9 of 16RESEA R C H Open AccessImpaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathwaySidhartha ... 49:1847-1858.doi:10.1186/1743-422X-7-36Cite this article as: Hazari et al.: Impaire d antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway. Virology Journal 2010...

Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf

... 22.6Cordia dichotoma Boraginaceae Clammy cherry, lasoori, gunda, Anti-inflammatory Leaves 14.1Colocasia esculenta Araceae Kachalu, Arvi Anti-diarrhea, anorexia, antipyretic. Leaves 21.5MomordicacharantiaCucurbitaceae ... organic solvents. These compounds wereanalysed for in- vitro antiviral activity against HCV NS3-SP, among which Epicatechin and Epigallocatechin andtheir dimers has in- vitro antiviral activity ... 8:26http://www.virologyj.com/content/8/1/26Page 4 of 7RESEARC H Open Access In- vitro antiviral activity of Solanum nigrum against Hepatitis C Virus Tariq Javed1†, Usman Ali Ashfaq1*†, Sana Riaz2, Sidra Rehman1, Sheikh Riazuddin3AbstractBackground:...

Báo cáo khoa học: " Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx

... Irshad-ur Rehman, Madiha Akram, Sobia Manzoor, Haji Akbar, Shazia Rafiqe and Sheikh RiazuddinAddress: National Centre of Excellence in Molecular Biology, 87-West Canal Bank Road Thokar Niaz Baig ... HCVinfections in North and South America, Europe, Russia,China, Japan, Australia, New Zealand and India [6,7].Type 4 is prevalent in Egypt, North Africa, Central Africa,and the Middle East; ... biotech_34@yahoo.com; Shazia Rafiqe - shaziarafique@gmail.com; Sheikh Riazuddin - riaz@ihr.comsats.co.pk* Corresponding author AbstractBackground: The variability within the hepatitis C virus...

Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf

... processes with a single compound, a new concept in antimalarial research.IntroductionAs long as effective vaccines against malaria remainunavailable, the search for new antimalarial drugs isstill ... Accordingly, an additionalinhibition assay was performed using P. falciparumprotein extracts and including cathepsin D (an asparticprotease) and the aspartic protease inhibitor pepstatin A ... the absorbance was measured at 610 nm. Datawere expressed as a percentage of the increase in absorbancecaused by the removal of zinc cations due to chelating activ-ity compared with a control...

Tài liệu Báo cáo khoa học: Intrinsic GTPase activity of a bacterial twin-arginine translocation proofreading chaperone induced by domain swapping ppt

... 525Intrinsic GTPase activity of a bacterial twin-argininetranslocation proofreading chaperone induced by domainswappingDavid Guymer1, Julien Maillard2, Mark F. Agacan1, Charles A. Brearley3and ... GTPases bindvery stably to GTP and have a very low intrinsic level of GTPase activity, and also require the action of GTPase activating proteins (GAPs), or the interaction with a speci c effecter, ... Foldingquality control in the export of proteins by the bacterialtwin-arginine translocation pathway. Proc Natl AcadSci USA 100, 6115–6120.4 Tullman-Ercek D, DeLisa MP, Kawarasaki Y, Iran-pour...

Tài liệu Báo cáo khoa học: The phosphatase activity of the isolated H4-H5 loop of Na+/K+ ATPase resides outside its ATP binding site docx

... usually complementary. The primersequence of the N398D construct was GCTGACACCACAGAGGATCAGAGTGGGGTCTCC and that of theD36 9A construct C CACCATCTGCTCCGCCAAGACTGGAACTCTGAC. The underlined ... 5¢-CTCCTGTGACCATGATGACCTAAATCCCAGC-3¢; I390–S601 sense with BglII site: 5¢-GC GTAGATCTATCCATGAAGCTGACACCACAG-3¢;antisense with EcoRI restriction site: 5¢-ATGAATTCGCGCTGCGGCATTTGCCCACAGC-3¢; L354–P588* ... 5¢-GGCCTTGGATAGCGTGTGCTAGGTTTCTGCCACCTC-3¢;L354–L527* sense with stop c odon: 5¢ -C CCCTGGACGAAGAGCTGTAAGACGCCTTTCAGAATGCC-3¢;the* means that antisense primers of the C- terminally shor-tened constructs...

Báo cáo khoa học: Investigating the role of the invariant carboxylate residues E552 and E1197 in the catalytic activity of Abcb1a (mouse Mdr3) docx

... (5¢-CTGGACGATGCAACATC-3¢) and E1197Nf(5¢-CTGGACAACGCAACATCAG-3¢) with primer pHIL–3¢r(5¢-GCAAATGGCATTCTGACATCC-3¢). The amplifi-cation products were purified on gel, mixed, denatured at94 C for ... (5¢-GATGTTGCATCGTCCAGAAG-3¢) and E1197Nr(5¢-GATGTTGCGTTGTCCAGAAG-3¢). A second over-lapping mdr3 cDNA fragment was amplified using muta-genic oligos E1197Af (5¢-CTGGACGCAGCAACATC-3¢),E1197Df (5¢-CTGGACGATGCAACATC-3¢) ... (5¢-GTGGCGTCGTCCAAC-3¢)and E552Nr (5¢-AGGTGGCGTTGTCCAAC-3¢). A secondoverlapping mdr3 cDNA fragment was amplified usingprimer pairs HincII (5¢-GAAAGCTGTCAACGAAGCC-3¢) and primer Mdr3-2008r (5¢-CTGTGTCATGACAAGTTTG-3¢)....

Báo cáo khoa học: The antibiotic activity of cationic linear amphipathic peptides: lessons from the action of leucine/lysine copolymers on bacteria of the class Mollicutes doc

... also for theantimicrobial activity of these peptides. In this work, wehave taken advantage of the fact that bacteria of the classMollicutes are devoid of an outer membrane and of a cellwall, ... bacteria fromsetting up appropriate countermeasures and lead to a rapidcell death if the peptide concentration is maintained above a critical threshold. In the case of bacteria like mollicuteswhich ... diﬀerent compositions and sequences werecompared for their antibacterial activities using cell wall-lessbacteria of the class Mollicutes (acholeplasmas, mycoplas-mas and spiroplasmas) as targets....

Báo cáo khoa học: Ion channel activity of brain abundant protein BASP1 in planar lipid bilayers pptx

... theform of discrete unitary conductance changes with evi-dence of open and closed states that are characteristic of ion channels. It is notable that cholesterol, which is a main component of lipid ... Neurosci 4, 38–43.30 Odagaki S, Kumanogoh H, Nakamura S & Maekawa S(2009) Biochemical interaction of an actin-cappingprotein, CapZ, with NAP-22. J Neurosci Res 87 , 1980–1985.31 Caroni ... 14, indicating that BASP1channels are cation-selective. The ion channel activity of BASP1 is in accordance with the pore-like structure of BASP1 oligomers observed byelectron microscopy on a...

Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot

... SRPK1,using as primers: forward: 5¢-TCCCCCGGGAATTTTCTTGTTATTCCCCTTGAG-3¢, containing the underlinedSmaI site and reverse: 5¢-CCGAGGAATTCGGAGTTAAGCCAAGGGTGCCG-3¢, containing the underlined EcoRIsite. ... containing theunderlined BamHI site and reverse: 5¢-TCCCCCGGGAGCAGTACTGACTGCAGATCC-3¢, containing the under-lined SmaI site. The cDNA coding for the C- terminus wasalso ampliﬁed by PCR from plasmid ... using as primers: forward 5¢-TTTGGATCCGAGCGCGAGCAGCGGG-3¢, containing the underlined BamHIsite and reverse: 5¢-TTGAATTCTTAGTAGCGGCGGGTGAA-3¢, containing the underlined EcoRI site. The PCRfragment...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ