0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus)" pptx

Báo cáo y học:

Báo cáo y học: "Illustrating risk difference and number needed to treat from a randomized controlled trial of spinal manipulation for cervicogenic headach" ppsx

... Thesemeasures can reveal important effects of care that are notreflected in the odds ratio, a statistic often reported forbinary data [5,7].Clearly, binary analysis is appropriate with naturallydichotomous ... by a chiropractor for the care of cervicogenic headache [11,13]. Spinal manipulation had a clinically important advantage over light massage inheadache pain, number, and disability; there was ... meaningful way of reporting binary outcomes from randomized trials. Analysis of continuous data from our randomized controlled trial has previously demonstrated a significant and clinically important...
  • 8
  • 292
  • 0
Báo cáo y học:

Báo cáo y học: "Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus)" pptx

... leucocephalus)Sagar M Goyal*, Naresh Jindal, Yogesh Chander, Muthanan A Ramakrishnan, Patrick T Redig, Srinand SreevatsanAbstract From April 2007 to March 2008, cloacal swabs were obtained from 246 casualty ... characterization of two subtypes of AIV from a single bald eagle (Haliaeetus leucocephalus). From April 2007 to March 2008, under an NIHfunded surveillance program on avian influenza, cloacalswabs ... study the raptor populationin detail to gain better understanding of AIV ecologyand epidemiology.AbbreviationsAIV: avian influenza virus; HPAI: highly pathogenic avian influenza virus; LPAI:low...
  • 4
  • 222
  • 0
Báo cáo y học:

Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"

... Paper ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME Ivan M Petyaev 1, Nayilia A Zigangirova 2, Alexey M Petyaev 3, Ulia P Pashko 2, Lubov ... OmpA of C. pneumoniae was employed. The outer (oCP1 – 5’ TTACAAGCCTTGCCTGTAGG 3’, oCP2 – 5’ GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT ... 56(6):423-31. 5. Shen D, Yuen HK, Galita DA, et al. Detection of Chlamydia pneumoniae in a bilateral orbital mucosa-associated lymphoid tissue lymphoma. American Journal Of Ophthalmology. 2006 Jun; 141(6):...
  • 10
  • 782
  • 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF9 of A. thaliana.These proteins b elong to the 2Cys-Prx subfamily. A ll plan t2Cys-Prx proteins, except BAS1 of barley, the ... 2002RESULTSIsolation of a 2Cys-Prx by using a single cysteinemutant of ChlamydomonasTrx hIn an attempt to isolate new T rx targets in Chlamydomonas, a s trategy w as used based o n the formation o f stable ... t rypsin. Thetryptic peptides were separated by HPLC and some of themwere totally or partially analyzed by Edman sequencingand/or by MALDI-TOF mass spectrometry ( Fig. 2).Computer database...
  • 11
  • 608
  • 0
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc

Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc

... laminarans by MALDI and FAB mass spectrometry.Carbohydr. Res. 310, 203–210.56. Elyakova, L .A. & Zvyagintseva, T.N. (1974) A study of thelaminarins of some Far-Eastern, brown seaweeds. Carbohydr ... digitata.The mode of action of the exo-1,3-b-glucanase onlaminarin from L. digitata was studied qualitatively by TLCand quantitatively by HPLC. HPLC analysis of the reactionmixture revealed that ... 5.0, andfractions with the exo-1,3-b-glucanase activity weredialyzed against buffer C, then against deionized water,and freeze dried.Enzyme assaysExo-1,3-b-glucanase activity was analyzed by...
  • 9
  • 554
  • 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

... +d+Lungc–+dNDLymph nodec–+dND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢.bPrimer pair: 5¢-GCCATTTTAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢.cPrimer pair: ... polyacrylamidegels. Antibody staining of sections from bovine prelactatingand lactating mammary gland using monoclonal andpolyclonal antibodies has shown that PAS III is largelyconcentrated on apical surfaces ... tail of 18 nucleotides. Two alternativepoly (A) signals [A( 1259)TAAA and A( 1430)ATTAAA]giving rise to poly (A) tails were observed by PCR-screening of the bovine mammary gland cDNA library.The...
  • 9
  • 614
  • 0
Báo cáo y học:

Báo cáo y học: " Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan" pptx

... sequenceBglII AGATCTDraI TTTAAAEcoRV GATATCNdeI CATATGMssI GTTTAAACSau3AI GATCSspI ACTAGTSwaI ATTTAAATXbaI TCTAGAFigure 9 Light (upper) and fluorescence (lower) images of Chlorella variabilis. A: ... –––––Sampling Sites: 1. Karasuma Pen., 2. Kita-Yamada, 3. Yabase Kihan Is., 4. Ohashi Marina, 5. Wani Fishing Port, 6. Aoyagi Beach, 7. Shirahige Beach, 8. Shin-AsahiWindmill Village, 9. Lake Yogo ... Hoshina1,2, Mayumi Shimizu2, Yoichi Makino2, Yoshihiro Haruyama2, Shin-ichiro Ueda2, Yutaka Kato2,Masahiro Kasahara2,3, Bun-ichiro Ono1,2, Nobutaka Imamura2,4*AbstractBackground:...
  • 10
  • 304
  • 0
Báo cáo y học:

Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot

... of MPs and the amount of differentantigens the non-parametrical Mann-Whitney test wasused. All data were analyzed using Prism 4 (GraphPadSoftware, Inc., La Jolla, CA). p values of less than ... and hydrostaticpulmonary oedema. Intra-alveolar MPs from ARDSpatients contain high levels of tissue factor, show anhighly procoagulant activity, and are likely contribute tointra-alveolar fibrin ... Spu-tum samples were directly spread-out in selective media,such as MacConkey agar for Pseudomonas aeruginosaand Alcaligenes xilosoxidans, manitol salt agar for Staph-ylococcus aureus, and BCSA for...
  • 8
  • 292
  • 0
Báo cáo y học:

Báo cáo y học: " Isolation of human β-defensin-4 in lung tissue and its increase in lower respiratory tract infection" ppt

... Hirakata Y, Tanaka H, Yoshida R,Tomono K, Koga H, Wada A, Hirayama T, Kamihira S: Evaluation of susceptibility of gram-positive and -negative bacteria tohuman defensins by using radial diffusion assay. ... Watanabe M, Yamashita T, Ogawa Y, Koh H, Hasegawa N,Nakamura H, Asano K, Yamaguchi K, Kotani M, Kotani T, Morisaki H,Takeda J, Kobayashi K, Ogawa S: New bronchoscopic microsam-ple probe to measure ... Jun-ichi Ashitani - jashi2@fc.miyazaki-u.ac.jp; Hiroshi Ishimoto - hiro08193103@yahoo.co.jp; Yukari Date - dateyuka@med.miyazaki-u.ac.jp; Hiroshi Mukae - hmukae@net.nagasaki-u.ac.jp; Naoyoshi...
  • 9
  • 302
  • 0
Báo cáo y học:

Báo cáo y học: " Isolation of a new HIV-2 group in the US" pptx

... epidemiology inSenegal: changes in HIV diversity. AIDS Res Hum Retroviruses2007, 23:1189-1196.2. Loeff MF van der, Awasana AA, Sarge-Njie R, Sande M van der, Jaye A, Sabally S, et al.: Sixteen years ... be accurately diagnosed. A falsely negative PCRresult may lead clinicians to infer that an individual'sinfection is latent or that the antibody tests are false posi-tives.These data demonstrate ... immunoblot was positive.The presumptive diagnosis was that Patient X had an HIV-2 infection. However, a PCR assay from a commercial lab-oratory for HIV-2 proviral DNA was negative (LabCorp,Research...
  • 3
  • 250
  • 0

Xem thêm

Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ