0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx

báo cáo khoa học:

báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx

... this article as: Lang et al.: Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection. BMC Plant Biology ... third of the strains exhibited more than 5%ARA with extraordinarily high values of 41.3% and 34.3% in Rhabdo monas incurva SAG 1271-8 and Khaw-kinea quartana SAG 1204-9. Interestingly, anotherstrain ... added into a database todocument the FA profiles of the studied microalgal strains. Results and Discussion1. A database of FA profiles from diverse microalgae The characterisation of FA profiles...
  • 16
  • 617
  • 0
Báo cáo khoa học: Human-blind probes and primers for dengue virus identification Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc

Báo cáo khoa học: Human-blind probes and primers for dengue virus identification Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc

... to each serotype of the virus (present in all strains of the serotype), and (d) unique to each individual viral strain’s genome(present in the strain and absent from all other strains) . The ... encephalitis, and dengue fever. One or more of the four serotypes of the dengue virus areendemic in many parts of the world, including all of south-east Asia, parts of Africa, and Southern and Central ... is in order to determine whe-ther it is, in fact, the optimal solution. For instance, a par-ticular set may exceed the minimum values required of a, b and c and, in fact, have values A, B and...
  • 11
  • 540
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "HIV-1 CRF 02 AG polymerase genes in Southern Ghana are mosaics of different 02 AG strains and the protease gene cannot infer subtypes" doc

... analysis. Conclusion: The polymerase genes of HIV-1 strains from Ghana are made up of recombinants of several CRF 02_AG strains from Ghana, Senegal and Cameroon, but the clinical implications areunknown. Using the ... analysis. Thus, the polymerase genes of HIV-1 strains from Ghanaare made up of recombinants of several CRF 02_AG strains from Ghana, Senegal and Cameroon, but the clin-ical implications are unknown. A continuous ... mosaics of different 02 AG strains and the protease gene cannot infer subtypesKwamena W Sagoe*1, Magda Dwidar2, Theophilus K Adiku1 and Max Q Arens2Address: 1Clinical Virology Laboratory,...
  • 6
  • 236
  • 0
báo cáo khoa học:

báo cáo khoa học: "Harmonic scalpel versus flexible CO2 laser for tongue resection: A histopathological analysis of thermal damage in human cadavers" potx

... 13.0 was maintained for the data entry and statistical analysis. Thermal depthbetween harmonic scalpel and CO2 laser was comparedusing Independent sample T-test. A p-value less than 0.05 was considered ... effective and p recise cutting tool in the head and neck region [3-6]. Each modality has their advantages and disadvantages. T he applicability of the laser particularly has been limited by line of ... the surgical tool used. Control tongue tissue was also sentfor comparison as a baseline.Data Entry and Statistical Analysis A M icrosoft Excel Spreadsheet and Statistical Packagefor the Social Science...
  • 6
  • 390
  • 1
Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

... vicinity of the active site (Fig. 2). Three of the six cation lig-ands are main-chain oxygen atoms, and three are the side-chain oxygen atoms of N296, E342 and S387. The glutamic acid and asparagine ... b-ketoacyl-ACPsynthases I and II, and a domain of human fatty acid synthase, have a Cys-His-His triad and also a completely conserved Lys in the active site.To examine the role of these residues in catalysis, ... unableto extend radiolabeled acetate (lane 5) in 30 min assaysat 42 °C. Addition of wild-type KAS I resulted in syn-thesis of long-chain saturated and unsaturated fattyacyl-ACPs in a protein...
  • 16
  • 450
  • 0
Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

... are enriched in SFAs, MUFAs, n)6PUFAs and n)3 PUFAs [23], as well as containing a range of other fatty acids, and these enrichments in u-ence the uptake and metabolism of the particles by the liver ... CRLPs containing highconcentrations of oleate may be metabolized more readily than TG from the other types of CRLP, caus-ing an increase in the release of the radiolabel as the free fatty acid for ... fatty acids are taken up more rapidly by macrophages than thoseenriched in n)6orn)3 polunsaturated fatty acids, and that the fasteruptake rate results in greater lipid accumulation in the case...
  • 9
  • 349
  • 0
Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx

Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx

... CATATCTGAAGTGTGAGCGTpdesI GAGAATGCCAAGTTGGAG TGTTGCAACACTTCCACGGTpdesK GTGTGAGTTATGGAACGAAG CTACTCACACTTGGCTTTACTpdesM GATTCATCCGTATCATAATAGTAAG TGGAACCTATGCCACCACTpdesN GTGAGAGCACTAACCAAGCTT CAATCAGTAGGCTTCGTCGTpdesO ... GAGAGGAAGTTCCGTCCTTG CAACGCAATCAATGAACGCTpdesB GTATGGATGCTACCGATG TGAATGTACAGATTGAACCTTpdesE GAGTTGATGAAGACATTGCG CTCCAACTGGTATTGCATTCTpdesG GATACTTCTTCATCTTGCACG CATATCTGAAGTGTGAGCGTpdesI GAGAATGCCAAGTTGGAG ... GCGGAGCTCCTATCCCTGAGCACACATTpdesI GCGGGATCCACCATGGCTGGAAAAGGAGGAGAC GCGAATTCTTACATGGCAGGGAAATCTpdesK GGGATCCATGGGCAACGGCAACCTCCCAG GGTCTAGACTACTCACACTTGGCTTTACCTpdesO CCCAAGCTTACCATGGCTCCCCCCAACGCCGAT GCTCTAGATTAGGCACTTCCAGACAAT....
  • 12
  • 618
  • 0
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot

Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot

... acylcar-nitine translocase and carnitine palmitoyltransferase II[5–7]. In case of the straight-chain and 2-methyl-branchedchain FAs, b-oxidation can start right away via the well-established cascade of four ... by all-trans retinoic acid (ATRA) in the hepatoma cell line HepaRG was shownto decrease CYP 4A1 1 gene and protein expression,ultimately leading to a decrease in catalytic activity(lauric acid ... (hexadecanoic acid) and the unsat-urated FAs oleic acid [(Z)-octadec-9-enoic acid] and arachidonic acid (all-cis-5,8,11,14-eicosatetraenoic acid) [34]. Recently, another CYP 4A subfamily member in humans...
  • 13
  • 475
  • 0
Báo cáo khoa học: Amino acid biosynthesis and metabolic flux profiling of Pichia pastoris ppt

Báo cáo khoa học: Amino acid biosynthesis and metabolic flux profiling of Pichia pastoris ppt

... 4,170–181.41. Takada, Y. & Noguchi, T. (1985) Characteristics of alanine:glyoxylate aminotransferase from Saccharomyces cerevisiae ,a regulatory enzyme in the glyoxylate pathway of glycine and serinebiosynthesis ... employed13C-labeling strategy (see text), its reactions are depicted in grey. The amino acids and the carbon fragments originating from a single intermediate of the central carbon metabolism are represented ... approachallows one to accurately map the metabolic state of the TCAcycle and associated pathways, thus being an importantmethodological expansion for investigating the metabo-lism of eukaryotic...
  • 9
  • 559
  • 0
Báo cáo khoa học: Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv doc

Báo cáo khoa học: Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv doc

... eluci-dated (see scheme in Fig. 6A) . In the active state(pH 6), the catalytic domains align as a closed dimercapable of binding ATP and of catalysis. In the in- active state (pH 8), the catalytic ... the inhibited state, the catalytic domains are recruited by the N-terminaldomains and unable to bind ATP. In Rv2212, fatty acids and a pHshift synergize to cause activation. Alternatively, a high ATP con-centration ... detergents.Biochemical properties of Rv2212 activationby fatty acids and polidocanolBecause of the unusually large variability in basal and linoleic acid- stimulated activities, we investigated whe-ther the...
  • 10
  • 257
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015