Báo cáo khoa hoc:" Technical challenges to surgical clipping of aneurysmal regrowth with coil herniation following endovascular treatment – a case report" doc

... of 5(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case report Technical challenges to surgical clipping of aneurysmal regrowth with coil herniation following ... present a case of aneurysm following failed endovascular treatment that required further sur-gery. Case presentation A 34-year-old woman was initially treated for a subarach-noid hemorrhage at another ... How-ever, as a result of the growing number of intracerebralaneurysms treated with endovascular coils, a new group of patients has arisen who have undergone endovascular treatment that has resulted...

Báo cáo khoa học: Evolutionary changes to transthyretin: evolution of transthyretin biosynthesis doc

... America, some marsupialsmigrated back to (what is now) North America andothers migrated across Gondwanaland. About 45 Ma,Gondwanaland began to break up into South America,Antarctica and Australia ... America to North America and via Antarctica to Australia; 3., extensive radia-tion of marsupials within Australia. (Data from [8 8–9 0]. Figure from[18], used with permission.)Evolution of transthyretin ... wasdown-regulated in M. domestica, a South Americanopossum [87]. As the common ancestor of eutheriansand marsupials is presumably more closely related to American marsupials than to Australian marsupialsor...

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

... One-hundredmicrograms fractionated nuclear extract from normal rat liver wastreated with diﬀerent concentrations of calf intestine alkaline phos-phatase (shown at the top) prior to its addition to EMSA. Lane ... sequence-speciﬁc a nity column chromatography and allfractions obtained were analysed spectrophotometrically. Absorbanceat 280 nm was measured and plotted. (B) Assessment of complexformation ability of ... positiveregulatory factor in rat liver and enhances transcriptionDipali Sharma*, Sujata Ohri and Aparna DixitGene Regulation Laboratory, Center for Biotechnology, Jawaharlal Nehru University,...

Báo cáo khoa học: Mitochondrial connection to the origin of the eukaryotic cell pdf

... 232 3–2 331.61. Kaneko, T., Nakamura, Y., Sato, S., Asamizu, E., Kato, T.,Sasamoto,S.,Watanabe ,A. ,Idesawa,K.,Ishikawa ,A. ,Kawa-shima,K.,Kimura,T.,Kishida,Y.,Kiyokawa,C.,Kohara,M.,Matsumoto, ... after a period of enthusiasm, new data appearedthat called into question the idea about the secondarilyamitochondriate nature of Diplomonada. First, an archaeal-type alanyl-tRNA synthetase (AlaRS) ... between anarchaebacterium and a eubacterium, and the shift in theappearance time of bacterial genes to the present day wasmerely due to involvement in the analysis of mitochondrialand a- proteobacterial...

Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt

... (errors are associated with empty table entries). The function GOTOright and GOTOfoo, take a state i and an auxiliary tree # and produce a state j. An example of a parsing table for a grammar ... Grammars, Modified Head Grammars, Linear In- dexed Grammars and Categorial Grammars (all of which generate the same subclass of context-sensitive languages) fall in the class of the so-called ... Pushdown Automaton 277 3 Bottom-up Embedded Push- down Automaton 3 For any TAG G, an EPDA can be designed such that its moves correspond to a top-down parse of a string generated by G (EPDA characterizes...

Báo cáo khoa học: "Special problems encountering surgical management of large retroperitoneal schwannomas" potx

... vstafyla@hotmail.com; Paraskevi Tsiantoula - vivi_tsiantoula@yahoo.gr; Anneza Yiallourou - annyiallo@yahoo.gr; Athanasios Marinis - sakisdoc@yahoo.com; Agathi Kondi-Pafitis - akondi@med.uoa.gr; ... Vaia K Stafyla1, Paraskevi Tsiantoula1, Anneza Yiallourou1, Athanasios Marinis1, Agathi Kondi-Pafitis2, Achilleas Chatziioannou3, Efstathios Boviatsis4 and Dionysios Voros1Address: ... 160:135-141.27. Hayasaka K, Tanaka Y, Soeda S, Huppert P, Claussen CD: MR find-ings in primary retroperitoneal schwannoma. Acta Radiol 1999,40:78-82.28. Yamamoto K, Miyagawa J, Katsura H: Retroperitoneal...

Báo cáo khoa học: "Giant breast tumors: Surgical management of phyllodes tumors, potential for reconstructive surgery and a review of literature" potx

... and cystosarcoma phyl-lodes was also conducted. Case presentation Case 1Patient A is a 64 year old white female who presented with a large right breast mass. The mass had been present for atleast ... HJ, Taylor HB: Relationship of histologic features to behavior of cystosarcoma phyllodes – analysis of ninety-fourcases. Cancer 1967, 20:2090-99.19. Treves N, Sunderland DA: Cystosarcoma phyllodes ... cervical, supraclavicular, or axillarylymphadenopathy was noted. The contralateral breastshowed no signs of a mass. Core tissue biopsy taken at thetime of presentation suggested a diagnosis of...

báo cáo khoa học: " Apospory appears to accelerate onset of meiosis and sexual embryo sac formation in sorghum ovules" doc

... othermorphometric variables of ovule development.AcknowledgementsFor technical assistance we thank Becky Kowallis, Aaron Lawyer, JohnCarman Jr., and Jayasree Pattanayak. We appreciate critical comments andsuggestions ... usually terminated by apoptosisfrom the MMC stage to early sexual ES forma tion. AESformation is detected cytologically as early as the MMCstage to as late as ES maturation. Timing of apospory ... cytological techniques and training, identified additionalimportant variables to analyze, and supervised data collection. EE and JGCanalyzed the data. JGC wrote the paper. All authors read and approved...

báo cáo khoa học:" An instrument to assess quality of life in relation to nutrition: item generation, item reduction and initial validation" potx

... preparato o par-tecipato alla preparazione di un pasto caldo per la suafamiglia o rispettato la stagionalità degli alimenti nelpreparare un pasto.|1| Mai|2| Quasi mai|3| Poche volte|4| Qualche ... set of 2576 participants. We based the allocation of the items of Qualcibo into do mains on factor analysis(principal component analysis with varimax rotation)and face validity as judged by ... contributed to collecting all but the reliability data andanalyzed data and wrote the first draft of this article. FS contributed to collecting all but the reliability data and analyzed data and reviewed...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan ... fw, forward; rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time ... Murotani G, Tanabe A, Saito K, Uehara K,Morise A, Sato M & Sanada H (2004) Differential effects of dietary fatty acids on rat liver a- amino-b-carboxymuc-onate-e-semialdehyde decarboxylase activity...

Xem thêm