Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps

... world: a panacea for all illnesses or a bubble about to burstNusrat Shafiq1, Samir Malhotra*1, Promila Pandhi1 and Anil Grover2Address: 1Department of Pharmacology, Post Graduate Institute ... pre-existing CAD. Collaborative Atorvastatin Diabetes Study(CARDS) was carried out to evaluate the efficacy andsafety of low-dose atorvastatin treatment in primary pre-vention of CAD in patients ... and against is available for several of these indications. The current review attempts to critically summarise the available data for each of these indications.Recently while browsing through the...

báo cáo khoa học: " Laboratory based surveillance of travel-related Shigella sonnei and Shigella flexneri in Alberta from 2002 to 2007" ppsx

... Tests for Bacteria that Grow Aerobically;Approved Standard. Wayne, Pennsylvania, USA: Clinical and LaboratoryStandards Institute;, 7 2006.17. Clinical and Laboratory Standards Institute: Performance ... Woodward D, Ahmed R, Clark C, Tabor H, Dore K,Ciampa N, Muckle A: Laboratory Surveillance Data for Enteric Pathogensin Canada: Annual Summary 2006. Winnipeg, Manitoba, Canada: PublicHealth Agency ... steven.drews@albertahealthservices.ca1Provincial Laboratory for Public Health (Microbiology)(ProvLab), Calgary,Alberta, CanadaFull list of author information is available at the end of the articleDrews et al....

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... or intramolecular interactions, allowingaccess to the AD. As the autoinhibition affected anunrelated AD when this was put in place of the nativeMeis2d AD, it appears that any intramolecular ... contain annuclear localization signal within the GBD part of the protein. Another possible explanation for the observedautoinhibitory activity is that the Hth domain mediatessome intramolecular ... domain, and thisautoinhibitory activity appears to be a general feature of Meis family proteins.Previous work has identiﬁed a transcriptional ADC-terminal to the HD of Meis 1a [40]. When assayed...

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... by the averageactivity of mutants in the central domain of 26% for WAF1 and 34% for MDM2, 71% for NOXA and 61% for p53R2, and around 45% for the other four promot-ers. For some speciﬁc mutants, ... [4–7]. The major drawback of these analyses is the lack of information regarding the activity or loss of activity of the target protein, as only a few variants (< 100)have been fully analysed. ... detected, the algo-rithm made a random change of another parameter inorder to circumvent the problem.When evaluating the PREDMUT algorithm, the goalwas to arrive at as accurate a prediction as possible...

Tài liệu Báo cáo khoa học: Substrate speciﬁcity of the pseudouridine synthase RluD in Escherichia coli doc

... (5¢-GCT ACAATA GCA CAC TAT ATT AAA CGG CAA AGC CGTAAA ACC CCG TGT AGG CTG GAG CTG CTT CG-3¢) and rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AATGTG AAA AGA AAA TCA CGC GTA CCG GAT CGTCTT GAT GGG AAT ... belongs to the RluA family [2]. Binding of RluA to one of its substrates, tRNAPheanticodonstem-loop, induces reorganization of the RNA [21]. Anability of the RNA substrate to adopt the alternativefold ... 7%polyacrylamide-urea gel. Radioactivity was visualized byTyphoon phosphor imager (GE Healthcare, Tokyo, Japan).AcknowledgementsThis paper is dedicated to the memory of ProfessorJames Ofengand...

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

... in a fully activatedform. The Arg316 fi Ala and Glu275 fi Ala substi-tutions appear to damage intrinsically the activationconformation to a level that BPA is unable to rescuecompletely.It was ... for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg316 fi Leu, and gag for Arg316 fi Glu). Each mutantLBD or full-length ERRc was amplified and cloned into the vector pGEX-6p-1 or pcDNA3.1(+) at ... functions.Evolutionary rationale for the major role of Arg316 in arresting the ligandWhen the amino acid sequences of the LBD of all the NRs were aligned to that of ERRc, it became notice-able that 26 receptors...

Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt

... CTAGCTAGCCCTGAAAGTAAGGAAAAAATGAAGAC(R) CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG5 (F) GGAATTCCATATGAGTGATAAAAACGCTAACGTC(R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) ... CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC16 (F) GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCCnewpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCAnewpetBOT ... GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC12 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC13 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R)...

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... binding sites of polyanions, are important for stabil-ization of the native conformation; the mutants investigated, in fact, all show an increased amount of the misligated H–Fe(III)–H state and, withrespect ... A obsis the absorbance at a given wavelength and at a given time interval, A ¥is the absorbance at longer timeintervals (when the reaction is completed), DAiis the absor-bance change for phase ... destabilization of the HSacid-denatured form, with further formation of the LS(IHH) A- state; (b) for the slow phase, to formation of the LS native-like (IHM) A- state. Unlike wild-typecytochrome...

Tài liệu Báo cáo khoa học: Co-operative effect of the isoforms of type III antifreeze protein expressed in Notched-ﬁn eelpout, Zoarces elongatus Kner ppt

... (b) the less active isoform (SP or QAE2) can then adsorb to the ‘open space’ between the prebound AFPs of the icecrystal surface; (c) most of the nfeAFP isoformsadsorb to the growth-terminated ... 2), and indeedis more soluble than the QAE isoform (data notshown). Hence, a plausible explanation for the sub-stantial content of the SP isoform is as follows: (a) the SP isoform is generated ... clearconcentration dependence on, the addition of a smallamount of a QAE1 isoform, nfeAFP8 (Fig. 7). This issimilar to the case of the QAE2 isoform, nfeAFP13; the activity of its monomer was enhanced...

Tài liệu Báo cáo khoa học: "On Learning Subtypes of the Part-Whole Relation: Do Not Mix your Seeds" pdf

... etal. (2006), have speciﬁcally targeted the discovery of part-whole relations from text. Furthermore,part-whole relations are de-facto benchmarks for evaluating the performance of general relation ... sub-categorize.Part-whole relations are also crucial for many in-formation extraction (IE) tasks (Girju et al., 2006).Annotated corpora and semantic dictionaries usedin IE, such as the ACE corpus1and ... contains → dobj+PART(2) a. Alle delen van de planten bevatten al-kalo¨ıden en zijn daarmee giftig (All parts of the plants contain alkaloidsand therefore are poisonous)b. WHOLE+obj1+van+mod+deel+su...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf lam the nao de tom tat bao cáo khoa hoc báo cáo khoa học báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam