N-terminal extension of the yeast IA 3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity Tim J. Winterburn 1 , Lowri H. Phylip 1 , Daniel Bur 2 , David M. Wyatt 1 , Colin Berry 1 and John Kay 1 1 School of Biosciences, Cardiff University, UK 2 Actelion Pharmaceuticals Ltd, Allschwil, Switzerland Gene-encoded inhibitors of aspartic proteinases are rather rare in nature. Thus, there is a need to under- stand the mechanisms of action of the few that are known, in order to exploit their therapeutic potential [1]. We have described previously one such inhibitor: the IA 3 protein from Saccharomyces cerevisiae [1–4]. This remarkable polypeptide not only is a highly potent inhibitor of its target enzyme, saccharopepsin, but also appears to be completely specific for this sole target proteinase [1,2]. Crystal structures solved for complexes of IA 3 with saccharopepsin revealed an unprecedented mechanism of action [2,3]. IA 3 from S. cerevisiae consists of 68 residues but all of the inhib- itory activity towards saccharopepsin resides within the N-terminal half or segment of the polypeptide [2,3]. The free inhibitor is essentially unstructured [5,6] but, upon contacting its target enzyme, residues 2–32 become ordered and adopt an alpha helical conforma- tion occupying the active site cleft of the proteinase [2,3]. This absolute selectivity for saccharopepsin was shown to be conferred by a combination of the K18 and D22 residues in the S. cerevisiae IA 3 sequence Keywords aspartic proteinase inhibition; IA 3 ; inhibitor engineering; Pichia aspartic proteinase; specificity relaxation Correspondence J. Kay, School of Biosciences, Cardiff University, Museum Avenue, Cardiff CF10 3US, UK Fax: +44 029 20 87 41 16 Tel: +44 029 20 87 41 24 E-mail: kayj@cardiff.ac.uk (Received 30 March 2007, revised 23 May 2007, accepted 25 May 2007) doi:10.1111/j.1742-4658.2007.05901.x Yeast IA 3 aspartic proteinase inhibitor operates through an unprecedented mechanism and exhibits a remarkable specificity for one target enzyme, sac- charopepsin. Even aspartic proteinases that are very closely similar to saccharopepsin (e.g. the vacuolar enzyme from Pichia pastoris) are not sus- ceptible to significant inhibition. The Pichia proteinase was selected as the target for initial attempts to engineer IA 3 to re-design the specificity. The IA 3 polypeptides from Saccharomyces cerevisiae and Saccharomyces castellii differ considerably in sequence. Alterations made by deletion or exchange of the residues in the C-terminal segment of these polypeptides had only minor effects. By contrast, extension of each of these wild-type and chimaer- ic polypeptides at its N-terminus by an MK(H) 7 MQ sequence generated inhibitors that displayed subnanomolar potency towards the Pichia enzyme. This gain-in-function was completely reversed upon removal of the exten- sion sequence by exopeptidase trimming. Capture of the potentially posi- tively charged aromatic histidine residues of the extension by remote, negatively charged side-chains, which were identified in the Pichia enzyme by modelling, may increase the local IA 3 concentration and create an anchor that enables the N-terminal segment residues to be harboured in clo- ser proximity to the enzyme active site, thus promoting their interaction. In saccharopepsin, some of the counterpart residues are different and, consis- tent with this, the N-terminal extension of each IA 3 polypeptide was with- out major effect on the potency of interaction with saccharopepsin. In this way, it is possible to convert IA 3 polypeptides that display little affinity for the Pichia enzyme into potent inhibitors of this proteinase and thus broaden the target selectivity of this remarkable small protein. Abbreviations Nph, L-nitrophenylalanine; PpPr, vacuolar aspartic proteinase from Pichia pastoris;Z,L-norleucine. FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3685 coupled with the requirement for an alanine residue to be present at position 213 in saccharopepsin [1]. A wide range of other aspartic proteinases of plant, parasite, vertebrate and fungal origin has been shown previously to be resistant to inhibition by IA 3 [2]. Included among these enzymes are a number with sequences that are very closely related to that of sac- charopepsin (e.g. the vacuolar aspartic proteinase from P. pastoris; PpPr) [1]. This shares a sequence identity of 77% with saccharopepsin and essentially all of the active site residues of saccharopepsin that contact the helical IA 3 inhibitor are identical in PpPr. PpPr also has the crucial Ala residue present at position 213 in its sequence. Despite this close relatedness, the two enzymes differ drastically in their susceptibility to inhi- bition by IA 3 . Accordingly, it was of considerable interest to examine whether IA 3 could be adapted to loosen its stringent specificity and, in this way, begin the process of engineering it to target aspartic protein- ase(s) other than saccharopepsin. Since PpPr is not inhibited effectively by IA 3 yet is so closely related to saccharopepsin, it was an obvious choice as the initial new target enzyme. In the present study, we show that, inter alia, inhibitors with subnanomolar potency against PpPr, can be generated by simply attaching a histidine-rich extension at the N-terminus of the IA 3 polypeptide. This dramatic alteration in behaviour may be explained by the positively ionisable histidine residues initiating additional contacts outside the active site that promote occupation of the active site of the target proteinase by the inhibitory segment. For ease of interpretation, residues in the inhibitors are denoted by single letter abbreviations while those from the proteinase are indicated in the three-letter code. Results and Discussion Wild-type IA 3 and PpPr We have reported previously that, at the standard pH of 4.7 that we have justified and used consistently in all of our earlier studies [1–4], wild-type IA 3 from S. cerevisiae has an inhibitory potency against saccha- ropepsin that is so tight that the K i value lies at or beyond the limits of accurate determination using the assay methodology available. It has thus been esti- mated as < 0.1 nm [1–4] and, in comparative terms, S. cerevisiae IA 3 is ineffective against PpPr (1; Fig. 1). 1 2 3 4 5 6 7 8 9 10 Identity Residue number M M M M (H) ZQ (H) ZQ N K D E 34242218 681 81 K (nM) 55 ± 11 15 ± 3 100 ± 20 NI 3 ± 0.5 4 ± 0.5 15 ± 5 280 ± 30 2 ± 0.2 10 ± 1 SMK H E N K D H N K D SMK SZK SZK KDS SZK SZK 2 Fig. 1. Inhibition at pH 4.7 of PpPr by wild-type and chimaeric forms of IA 3 from S. cerevisiae and S. castellii. Sequences of IA 3 from S. cere- visiae and S. castellii (detailed in Fig. 2) are depicted schematically by dark-shaded and open boxes respectively, with residues at positions 1, 2, 18, 22 and 68/81 identified individually. Inhibitors 1-3 and 5 were recombinant proteins containing an additional LE(H) 6 sequence attached to the C-terminal residue (E68 for 1 & 5; H81 for 2 & 3). Inhibitors 4 and 6-10 were synthetic peptides of the indicated length. In these forms of IA 3 , L-norleucine (Z) was substituted for methionine. NI = no inhibition at 2 lM. N-terminal extension of IA 3 T. J. Winterburn et al. 3686 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS We have also reported previously that our constant searching of the sequence databases for orthologues of S. cerevisiae IA 3 enabled us to identify the counter- part polypeptide from Saccharomyces castellii [1]. To determine whether the S. castellii polypeptide might be a more effective inhibitor of PpPr upon which to base initial protein engineering studies, it was produced in recombinant form in Escherichia coli and purified to homogeneity as described in the Experimental procedures. The S. castellii IA 3 was, however, only marginally more effective as an inhibitor of PpPr than its S. cerevisiae counterpart (cf. 2 and 1; Fig. 1). The effect of C-terminal segment residues on the inhibitory activity of the N-terminal segment The sequences of IA 3 from S. castellii and S. cerevisiae are aligned in Fig. 2. These show only 45% identity in the N-terminal ‘segment’ (residues 2–32) that has been demonstrated previously to contain the inhibitory activity towards saccharopepsin [1–4]. Residues 33–35 are identical in both sequences and form a link between the inhibitory N-terminal ‘segment’ and resi- dues of the C-terminal ‘segment’. The C-terminal seg- ment (residues 36–81; Fig. 2) from S. castellii IA 3 is considerably longer than its counterpart (residues 36–68) in the S. cerevisiae polypeptide and differs sub- stantially in sequence (Fig. 2). To establish whether the respective C-terminal segments might have an influence (beneficial or detrimental) on any inhibitory activity that might be intrinsic to the N-terminal segments, chimaeric proteins were engineered in which residues 35–81 and 35–68 in the respective polypeptides were replaced by their counterparts from the other sequence. The chimaera that consisted of residues 1–34 from S. cerevisiae IA 3 fused to residues 35–81 from the S. castellii sequence remained as poor an inhibitor of PpPr as the wild-type S. cerevisiae IA 3 (cf. 3 and 1; Fig. 1). A shorter variant of the S. cerevisiae poly- peptide which terminated at residue 34 and so was completely devoid of any residues whatsoever to correspond to positions 35–68 ⁄ 81, did not inhibit PpPr either (4; Fig. 1). Thus, the N-terminal segment of S. cerevisiae IA 3 does not have any significant effect on PpPr, irrespective of the absence, presence or nature of the residues contributing the C-terminal segment. Against saccharopepsin, S. cerevisiae-based inhibi- tors 3 and 4 both had K i values of < 0.1 nm at pH 4.7, just as reported previously for the full-length, wild-type S. cerevisiae polypeptide (inhibitor 1) [2–4]. Entirely in keeping with these earlier findings, the nat- ure and indeed presence or absence of residues beyond position 34 in this sequence would appear to have no influence on inhibition of saccharopepsin. The reciprocal chimaera, which consisted of residues 1–34 from S. castellii IA 3 fused to residues 35–68 from the S. cerevisiae polypeptide, was slightly more effect- ive as an inhibitor of PpPr than the wild-type S. castellii IA 3 (cf. 5 and 2; Fig. 1), with the measured K i falling into the single digit nanomolar range. Since these two polypeptides differ only in the nature of their C-terminal segments, it would appear that the C-terminal segment (residues 35–81) from S. castellii IA 3 has a slight detrimental effect on the inhibitory activity against PpPr that is intrinsic to its own N-ter- minal segment. This interpretation was examined by producing a shorter variant of the S. castellii sequence that lacked any C-terminal segment and so consisted only of residues 2–34. This had a comparable inhibi- tory potency to that of the chimaera (cf. 6 and 5; Fig. 1). The detrimental effect of S. castellii residues 35–81 may result from adverse interaction(s) occurring either within the full-length S. castellii polypeptide (residues 1–81) itself or between the C-terminal seg- ment of the polypeptide and PpPr at a remote site far removed from the active site cleft where the N-terminal segment might be expected to bind. Furthermore, because the chimaeric inhibitor 5 had a comparable potency to that of inhibitor 6 which was devoid of any C-terminal segment, the C-terminal segment (residues 35–68) from S. cerevisiae IA 3 would appear, once again, to be inert, this time being without influence on the inhibitory activity against PpPr that is intrinsic to the N-terminal segment of the S. castellii polypeptide. Against saccharopepsin, the S. castellii N-terminal segment (inhibitor 6) is a potent inhibitor (K i ¼ 0.4 ± 0.1 nm at pH 4.7) and the interactions of this type of inhibitor variant within the active site cleft of the enzyme have been documented previously [4]. The counterpart N-terminal segment (residues 2–34) from Species Sequence S. cerevisiae S. castellii Fig. 2. Alignment of the sequences of IA 3 from S. cerevisiae and S. castellii. Identical residues are boxed in black. T. J. Winterburn et al. N-terminal extension of IA 3 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3687 S. cerevisiae IA 3 (inhibitor 4) is even more effective than inhibitor 6 against saccharopepsin (K i < 0.1 nm) [1–4]. This behaviour stands in stark contrast to that observed against PpPr where inhibitor 6 was > 500- fold more effective than inhibitor 4 (Fig. 1). Conse- quently, the effect of exchanging residues within the inhibitory sequence of 6 was examined. Replacement of the S. castellii residues 24–34 by the corresponding residues from S. cerevisiae IA 3 had only a small (three- to four-fold) adverse effect on inhibitory potency against PpPr (cf. 7 and 6; Fig. 1). However, when the key residues K18 and D22 that have been shown to be so important in restricting the activity of S. cerevisiae IA 3 to saccharopepsin as its sole target proteinase were introduced into the S. castellii sequence in place of the intrinsic M18 ⁄ K22 pair, the inhibitory activity against PpPr was essentially destroyed (cf. 8 and 6; Fig. 1). Thus, it would appear that the residues at positions 18 and 22 again play a decisive role, allowing effective inhibition of PpPr by the S. castellii polypeptide. Changes in other locations, including the ‘remote’ attachment of residues 35–81 from its own C-terminal segment, cause only minor perturbation of the inhibi- tory potency intrinsic to the N-terminal segment. The effect of extending the N-terminal segment Since the above-described adaptations in the C-ter- minal segment were without major influence, the effect of extending the inhibitory segment (residues 2–34) at its N-terminal end was investigated next. Careful consideration was given to the design of the N-terminal extension sequence that was to be intro- duced. Insufficient amounts of PpPr were produced for crystallization attempts to be a realistic possibility; thus, the design process was informed by a 3D model for PpPr that was generated based on the crystal structures that have been reported previously for saccharopepsin complexed with different variants of S. cerevisiae IA 3 [2,3]. The two proteinases share 77% sequence identity, and they are likely to have closely similar 3D structures. Inspection of the PpPr model identified a patch of negatively ionisable amino acids on the surface of the enzyme, adjacent to the end of the active site cleft where the N-terminal residues of an inhibitory IA 3 helix would be expected to bind (Fig. 3A). Extension of the inhibitory sequence of IA 3 at its N-terminus by four amino acids (residues X8– X11, Fig. 3B) was estimated to generate a polypeptide that would make few beneficial contacts, whereas a seven amino acid extension (consisting of residues X5–X11, Fig. 3B) would be long enough to make some of the predicted contacts with the side-chains of residues such as Asp161, Asp164 and Glu17 on the surface of PpPr; and an extension of nine amino acids (residues X3–X11) would exploit the potential binding site offered by this patch to the full (Fig. 3B). Consequently, IA 3 variants with four (HHZQ) and seven (HHHHHZQ) residue extension sequences, respectively, were designed initially to introduce the appropriate number of potentially positively charged (at the experimental pH of 4.7) histidine residues (at positions X8–X9 or positions X5–X9, respectively) followed by a norleucine residue (indicated by Z, at position X10) and a glutamine (residue X11) in place of the naturally occurring N-terminal (methionine) A B Fig. 3. Representation of PpPr and the extension residues of IA 3 . (A) Negatively ionisable surface residues (red) adjacent to the edge of the active site of PpPr; the active site is occupied by a putative helical IA 3 inhibitor with the residue at its N-terminus serving as a potential attachment point for an extension; (B) potential interac- tions of the indicated negatively ionisable surface residues (red) of PpPr with several positively ionisable amino acids of the MK(H) 7 MQ extension sequence (residues X1–X11, respectively). The C-alpha representation of the helical inhibitory segment occu- pying the active site of the proteinase is depicted in yellow. N-terminal extension of IA 3 T. J. Winterburn et al. 3688 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS residue of IA 3 which has been shown previously to be unimportant for inhibitory activity [1,2]. The logic for introduction of the Q residue is explained below; inspection of the PpPr model revealed an additional pocket that might accommodate the side-chain of straight-chained residues such as norleucine (in syn- thetic peptides) or methionine (in recombinant pro- teins) at position X10 (Fig. 3B). These two extension sequences were introduced at the N-terminus of inhibitor 7. This inhibitor was selec- ted initially because it consists only of residues 2–34 and was thus free of any potential ‘complications’ that might have been contributed to binding by the pres- ence of residues 35–68 ⁄ 81. Since it was also only a weak inhibitor of PpPr, any improvement in inhibitory potency should be readily quantifiable. The polypep- tide containing the short, four-residue (HHZQ) exten- sion had a comparable potency to that of its parent (i.e. non-extended inhibitor 7) (cf. 9 and 7; Fig. 1). However, the longer (H) 5 ZQ-extended variant showed a seven-fold improvement in potency against PpPr (cf. 10 and 7; Fig. 1). Since this seven-residue extension was already suffi- cient to engender an improvement of inhibitory potency against PpPr, the extension sequence was lengthened further to include all seven histidine resi- dues indicated by the model. The additional two histi- dine residues (at positions X3 and X4; Fig. 3B) were introduced downstream from a methionine and a lysine residue (at positions X1 and X2, respectively), the logic for which will be substantiated below. These four MKHH residues were thus introduced upstream from the (H) 5 -containing extension described above to generate the sequence MK(H) 7 MQ (Fig. 3B). Coinci- dentally, this extension contains sufficient histidine res- idues to enable it to be used as an affinity tag for purification purposes. In all of our previous studies with IA 3 [1–4], recombinant protein versions such as inhibitors 1–3 and 5 (Fig. 1) were purified to homogen- eity from E. coli lysates by nickel-chelate chromatogra- phy, facilitated by a LE(H) 6 tag that was positioned at the C-terminus of each polypeptide. This tag was shown to have no effect on the potency of inhibition of saccharopepsin [2,3]. This C-terminal His-tag could thus be deleted and introduced instead within the extension sequence at the N-terminus of each desired polypeptide. The 11 amino acid-containing sequence MK(H) 7 MQ was thus introduced as the N-terminal extension attached to residue 2 of S. castellii IA 3 , as described in the Methods section. The resultant, recombinant pro- tein (and the others to be described) were purified from E. coli cell lysates just as readily as their C-ter- minally tagged predecessors using exactly the protocol described previously for the latter [1–4]. The N-termin- ally extended S. castellii protein showed a potency against PpPr that was improved by 150-fold compared to its counterpart with the tag at the C-terminus of the polypeptide (cf. 11; Fig. 4; 2, Fig. 1). With such a dra- matic benefit from extension of the inhibitory segment at its N-terminus, it was clearly of importance to establish whether this enhanced potency was influenced to any extent by the presence ⁄ absence and nature of the amino acid residues contributing the C-terminal segment to this polypeptide. Consequently, the residues (35–81; Fig. 2) comprising the C-terminal segment were systematically deleted, in blocks of 12 ⁄ 13 residues at a time. Truncation of the N-terminally tagged S. castellii polypeptide (inhibitor 11) at residue Q68 generated inhibitor 12 which corresponded in overall length to S. cerevisiae IA 3 . Although this resulted in a seven-fold weakening in potency against PpPr (cf. 12 with 11; Fig. 4), a subnanomolar K i value was still recorded for inhibitor 12. Further truncation at resi- dues Y57 and K45, respectively (inhibitors 13 and 14; Fig. 4) did not cause any further significant loss of inhibitory potency against PpPr. Thus, in contrast to the detrimental effect that was described above when residues 35–81 were attached in the full-length, C-terminally tagged inhibitor 2, the presence of residues 69–81 at the C-terminus of the N-terminally tagged S. castellii polypeptide appears to confer a benefit to the inhibition of PpPr (cf. inhibitors 11 and 12; Fig. 4). This was substantiated by the data obtained for the chimaeric inhibitor 15 (Fig. 4) which was identical in length to inhibitor 12 but contained residues 35–68 from S. cerevisiae IA 3 as the C-terminal segment in place of the counterpart S. castellii residues of inhibitor 12. Both inhibitors had comparable K i values against PpPr (15 and 12; Fig. 4). Consequently, the nature of residues 35–68 at the C-terminus of these N-terminally tagged polypeptides would appear to be unimportant for inhibition. Quantitatively, the magni- tude of the beneficial effect conferred by residues 69–81 from the S. castellii sequence is small compared to that achieved by location of the full-length extension at the N-terminal end of the polypeptide. The benefit of these alterations at each extremity of the polypeptide chain, must of necessity arise from contacts that are made outwith the active site of the enzyme. The effect of removal of the N-terminal extension The full N-terminal extension sequence, MK(H) 7 MQ, was designed to consist of an even number of residues upstream from the Q residue. This enables their T. J. Winterburn et al. N-terminal extension of IA 3 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3689 removal by the action of a diamino exopeptidase, cath- epsin C, which cleaves off dipeptides sequentially from the N-terminus of a polypeptide [7]. The first methion- ine (X1) in the extension sequence is necessary for translation initiation and the lysine is located at position X2 so that in the event of removal of the N-terminal methionine residue by an E. coli amino- peptidase, the new N-terminal lysine residue would prevent any digestion by cathepsin C [7]; such a desM(X1)-extended IA 3 would still contain its His-tag and so could be removed by nickel-chelate chromato- graphy. Unlike an N-terminal lysine residue, glutamine (at position X11; Fig. 3) does not in itself constitute a stop point for cleavage by cathepsin C. However, if dipeptide removal by cathepsin C is performed in the presence of an excess of glutamine cyclotransferase, once an N-terminal glutamine residue is newly exposed, it is rapidly converted into pyroglutamic acid. Further digestion by cathepsin C is thus prevented, leaving the cyclised Q as the N-terminal residue (replacing the nat- urally occurring Met1) of each IA 3 polypeptide. Appli- cation of this trimming treatment to the longest and shortest variants with the wild-type S. castellii sequence (inhibitors 11 and 14) and to the chimaeric inhib- itor 15, generated polypeptides 11T, 14T and 15T, respectively, each with a pyrrolidone carboxylic acid residue (cyclised Q) at its N-terminal end (Fig. 4). Each trimmed polypeptide was purified as described in the Experimental Procedures section by passage through a nickel-chelate column to remove any residual parent IA 3 with its intact histidine tag together with the two enzymes used in the trimming procedure which are also both C-terminally His-tagged. The purity, identity and concentration of each trimmed polypeptide was deter- mined by MALDI-TOF mass spectrometry and amino acid analysis. As a representative example, the spectra for one of these inhibitor pairs (14 ⁄ 14T) are depicted in Fig. 5. The mass peak observed in the spectrum for the parent inhibitor 14 (Fig. 5A) corresponds to the theor- etical value for the N-terminally extended S. castellii IA 3 variant terminating at K45 as its C-terminus. After treatment with the cathepsin C ⁄ glutamine cyclotrans- ferase enzyme combination, this peak was completely absent in the 14T sample. Instead, a peak with a smal- ler mass (4983 Da; Fig. 5B) was observed which corres- ponds to that expected (4983 Da) for the trimmed IA 3 polypeptide devoid of the histidine-rich extension but with an N-terminal pyroglutamate residue. The compo- sition of 14T determined by amino acid analysis was (residues ⁄ mol) Asp 4.9 (5); Thr 1.0 (1); Ser 4.7 (5); Glu 6.7 (8); Gly 1.8 (2); Ala 5.6 (6); Val 1.3 (1); Met 2.3 (5); Leu 1.0 (1); Phe 1.2 (1); Lys 8.5 (8), with the theoretical 11 11T 12 13 14 14T 15 15T 16 16T Identity Residue number *Q MK(H) MQ 34 68 1 81 K i (nM) 0.1 ± 0.1 30 ± 4 0.7 ± 0.1 K Saccharopepsin PpPr MK(H) MQ MK(H) MQ 0.3 ± 0.2 4 ± 0.3 Q 0.8 ± 0.1 45 57 S Y MK(H) MQ MK(H) MQ MK(H) MQ S SK S H S H *Q S 1.1 ± 0.1 2 ± 0.3 0.9 ± 0.1 0.9 ± 0.4 30 ± 10 10 ± 2 0.4 ± 0.1 0.7 ± 0.2 15 ± 1 1.5 ± 0.2 0.6 ± 0.2 <0.1 100 ± 10 <0.1 E S E S E N 2 *Q *Q NE NE Fig. 4. Inhibition at pH 4.7 of PpPr and S. cerevisiae (saccharopepsin) by variant forms of IA 3 from S. castellii and S. cerevisiae. Sequences of IA 3 from S. castellii and S. cerevisiae are depicted by open and dark-shaded boxes respectively, with residue 2 and the C-terminal residue of each length variant identified individually. The MK(H) 7 MQ extension was positioned upstream from residue 2 at the N-terminus of inhibi- tors 11-16. Inhibitors 11T, 14T, 15T & 16T were generated by removal of this extension by cathepsin C trimming to leave a cyclised Q resi- due (= *Q) at the N-terminus of each polypeptide. N-terminal extension of IA 3 T. J. Winterburn et al. 3690 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS values given in parentheses. Histidine was absent, indi- cating the purity of the trimmed polypeptide that resulted from the chromatographic procedures (see Experimental procedures) and substantiating the complete absence of His-tagged parent polypeptide or any partially-processed intermediate. Directly compar- able results were obtained for all of the other inhibitor pairs described in Fig. 4 (data not shown for brevity). For the chimaeric 15 ⁄ 15T pair and the shortest 14 ⁄ 14T pair, removal of the N-terminal extension in this way resulted in an approximately 35-fold loss in potency against PpPr (Fig. 4). In the case of the full- length S. castellii protein, however, an even larger loss in potency (approximately 300-fold) against PpPr resulted from trimming off the N-terminal extension (cf. 11T and 11; Fig. 4). Indeed, the trimmed polypep- tide showed a potency against PpPr that was compar- able to that measured for the original S. castellii protein tagged at its C-terminus (cf. 11T; Fig. 4; 2, Fig. 1). Inhibitors 11T and 2 differ only in having (1) a cyclised Q in place of the Met1 residue at the N-ter- minus and (2) the C-terminal LE(H) 6 tag. It would thus appear that appending the His-tag at the C-termi- nus of the authentic S. castellii polypeptide is without significant effect. By contrast, introduction of the histi- dine-rich extension at the N-terminal end of the S. castellii polypeptide transforms it into an inhibitor with subnanomolar potency against PpPr. Since IA 3 from S. cerevisiae had been shown above to be an even poorer inhibitor of PpPr, the effect of extend- ing this polypeptide at its N-terminus was also exam- ined. Introduction of the MK(H) 7 MQ extension at the N-terminal end of wild-type S. cerevisiae IA 3 resulted in an improvement of approximately 100-fold in inhibitory potency against PpPr relative to the C-terminally tagged polypeptide (cf. 16; Fig. 4; 1, Fig. 1). This modification thus transformed the ineffective polypeptide 1 into a highly potent inhibitor with a subnanomolar K i value against PpPr (16; Fig. 4). Once again, however, this gain in potency was completely lost upon removal of the N-terminal extension by treatment with cathepsin C. The resultant, trimmed S. cerevisiae IA 3 reverted to being as mediocre an inhibitor of PpPr as the original construct with its C-terminal tag (cf. 16T; Fig. 4; 1, Fig. 1). Binding effects An explanation for these effects may be advanced based on remote interactions that occur outwith the active site cleft of the target proteinase. Free IA 3 is predominantly unstructured [5,6]. Neither S. cerevisiae nor S. castellii IA 3 show any significant intrinsic affin- ity for PpPr (inhibitors 1 and 16T and 2 and 11T) and so the E + I « EI equilibrium lies well to the left. When the extension with its multiple, positively ionisa- ble histidine residues (at pH 4.7) is attached at the N-terminus of these polypeptides, the potential capture by the residues of the largely negatively charged surface adjacent to the edge of the active site cleft (Fig. 3A) may increase the local inhibitor concentra- tion and help to locate the residues of each N-terminal IA 3 segment in closer juxtaposition to the active site of the enzyme. This anchoring function of the extension residues may allow inhibitory sequences, which, by A B Fig. 5. MALDI-TOF mass spectrometry analysis of S. castellii IA 3 terminating at K45 before (A) and after (B) removal of the N-ter- minal extension by cathepsin C ⁄ glutamine cyclotransferase. (A) The peak at 6327 Da corresponds to that expected theoretically (6334 Da); the 3168 Da peak is most likely the doubly charged ion. (B) The observed mass peak coincides with that predicted (4983 Da) for the trimmed polypeptide. The 2496 Da peak is prob- ably the doubly charged ion and no peak is present at 6327 Da cor- responding to the parent, untrimmed peptide. T. J. Winterburn et al. N-terminal extension of IA 3 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3691 themselves are suboptimal, to reside long enough in the vicinity of the enzyme matrix to consolidate the helical arrangement that ensures a successful, tight interaction with the enzyme. Whereas two histidine residues (X8 and X9; Fig. 3B) were insufficient for this purpose, five residues (X5–X9) resulted in an increase in potency of almost an order of magnitude against PpPr, with the X5 and X6 histidine residues potentially establishing contacts with Asp164 and Glu17, respect- ively, of the enzyme (Fig. 3B). Addition of a further two histidine residues (X3 and X4) and a lysine at X2 consolidated this effect even more, resulting in a further, more substantial gain in potency. Since neither Glu17 nor Asp164 is conserved in the sequence of saccharopepsin, the validity of this inter- pretation was examined by determination of inhibition constants for the interaction of the N-terminally exten- ded inhibitors with saccharopepsin. The potencies of inhibitors 9 (containing two histidines) and 10 (five his- tidines) against this enzyme were closely similar and comparable to that of the parent inhibitor 7 ( K i ¼ 0.4 ± 0.1, 0.3 ± 0.1 and 0.8 ± 0.1 nm, respectively). Further lengthening to include all seven histidine resi- dues of the MK(H) 7 MQ sequence resulted in extended inhibitors that were only two- to ten-fold more potent against saccharopepsin than their respective, trimmed counterparts (cf. 15T and 15, 14T and 14 and 11T and 11; Fig. 4). Indeed, the trimmed S. castellii polypeptide (inhibitor 11T; Fig. 4) had a potency against saccharo- pepsin that was identical to that reported previously [1] for the C-terminally histidine-tagged counterpart (inhibitor 2) of this sequence (K i ¼ 4 ± 0.1 nm). Saccharomyces castellii IA 3 is thus a weaker inhibitor of saccharopepsin than S. cerevisiae IA 3 (K < 0.1 nm) [1–4]. From this evidence, it would appear that Glu17 and Asp164 may be responsible, at least in part, for facilitating the substantially increased binding of N-ter- minally extended inhibitors to PpPr because these two are among the few amino acids in this region with a number of negative-ionisable residues, that are not conserved in saccharopepsin. Site-directed mutagenesis to introduce each of these residues, separately and together, in place of their wild-type counterparts in saccharopepsin would enable further substantiation of this interpretation. Consistent with this conclusion, however, the N-terminally extended and trimmed vari- ants of S. cerevisiae IA 3 were both potent inhibitors of saccharopepsin, to the extent that each K i value was too tight for accurate quantitation (inhibitors 16 ⁄ 16T; Fig. 4). For this pair of proteins, the interactions made by residues 2–34 of S. cerevisiae IA 3 upon encounter- ing the active site of saccharopepsin, are already opti- mized and so are sufficient by themselves to facilitate tight, specific binding of this helical N-terminal seg- ment of IA 3 . The E + I « EI balance thus lies far to the right and the addition of further residues at the N-terminus or beyond residue 34 of the inhibitory segment is superfluous. However, in the case of PpPr, the serendipitous positioning of negatively ionisable residues in a patch adjacent to but remote from the active site provides a capture site for positively ionisa- ble residues in the N-terminal extension. By this device, it is thus possible to transform IA 3 polypep- tides with little intrinsic affinity for PpPr into inhibi- tors with subnanomolar potency against this enzyme as a target proteinase. For aspartic proteinases that do not possess this fortuitous surface feature and which are more distantly-related to saccharopepsin, including those of clinical ⁄ agricultural relevance, it would appear likely that changes will need to be made within the inhibitory sequence of the N-terminal segment itself in order to re-target the inhibitory activity of IA 3 . Experimental procedures Saccharopepsin and the vacuolar aspartic proteinase from P. pastoris (PpPr) were produced in recombinant form and purified from each culture medium, as described previously [1]. The N-terminal sequence determined for the purified PpPr was Ala-Ser-His-Asp-Ala-Pro-Leu-Thr-Asn-Tyr-Leu- Asn, which corresponds to that of the mature form of the proteinase predicted by the DNA sequence. Wild-type IA 3 polypeptides from S. cerevisiae and S. cas- tellii were produced in E. coli with an additional LE(H) 6 sequence attached at the C-terminus and purified to homo- geneity by nickel-chelate chromatography, as described pre- viously [1–4]. Chimaeric and N-terminally extended IA 3 variants were produced by engineering cassette versions of the DNA encoding S. cerevisiae IA 3 in the pET-22b expres- sion plasmid (Novagen, Milton Keynes, UK). An unwanted SacI site near the 3¢-end of the IA 3 coding sequence was removed and an NheI site was introduced as a silent muta- tion in the codons for Ala34–Ser35 (GCT AGT fi GCT AGC) by separate site-directed mutageneses using the Quikchange Kit (Stratagene, Amsterdam, the Netherlands), as described previously [1]. Digestion of the resultant plas- mid (J35-pET22b) with NdeI–NheI enabled removal of the bases encoding S. cerevisiae residues 1–34 whereas digestion with NheI–XhoI permitted excision of the nucleotides enco- ding residues 35–68. The respective excised fragments were replaced with DNA encoding the corresponding residues 1–34 (inhibitor 5) or 35–81 (inhibitor 3) from S. castellii IA 3 . Each relevant segment was amplified by PCR using S. castellii IA 3 DNA as template and oligonucleotide pairs containing the appropriate restriction enzyme sequence (Table 1). The authenticity of each construct was confirmed by sequencing. In this way, pET22b plasmids were gener- N-terminal extension of IA 3 T. J. Winterburn et al. 3692 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS ated encoding chimaeric polypeptides which consisted, respectively, of residues 1–34 from S. castellii followed by residues 35–68 from S. cerevisiae IA 3 (inhibitor 5, Fig. 1) or residues 1–34 from S. cerevisiae followed by residues 35–81 from S. castellii (inhibitor 3, Fig. 1). To generate IA 3 polypeptides each extended at its N-ter- minus and devoid of the LE(H) 6 tag at the C-terminus, a further cassette vector was engineered by making use of the XbaI site that is located in the cloning region of pET-22b upstream from both the NdeI and ribosome binding sites. pET-22b carrying S. cerevisiae IA 3 DNA as the insert was digested with XbaI–NdeI and gel purified to remove the excised 43 bp fragment. It was replaced by a pair of syn- thetic oligonucleotides (newpet TOP ⁄ BOT; Table 1) which reconstituted the sequence between the XbaI and NdeI sites and introduced the additional bases required to encode most [MK(H) 6 HM] of the desired N terminal extension in the correct frame, restoring the NdeI site (CAT ATG) which coincidentally encodes the HM residues (at positions X9–X10) of the extension sequence. Clone screening was faci- litated by the introduction of a new HindIII site (AAG CTT) between the ribosome-binding and NdeI sites and the new expression vector engineered in this way was called newpet-22b. To introduce the final Q residue (at position X11) of the desired extension and to remove the C-terminal LE(H) 6 tag from the required constructs, oligonucleotide primers were designed to anneal to the 5¢- and 3¢-ends of the target DNA encoding S. cerevisiae, S. castellii or chimaeric IA 3 of each desired length. Each forward primer consisted of an NdeI consensus sequence followed by a Gln codon before continuing inframe at the codon for residue 2 of the relevant IA 3 sequence. Each reverse primer encoded stop codons in all three frames after the final desired IA 3 codon to ensure the appropriate target polypeptide length. PCRs were performed with the high-fidelity PfuUltra TM polymerase (Stratagene). Following gel purification, each amplicon was treated with NdeI and XhoI, prior to ligation into the newpet-22b vector that had been similarly digested. Sequencing confirmed the authenticity of each construct. In this way, pET-22b plasmids encoding inhibitors 11–16 , each with an N-terminal MK(H) 6 HMQ extension (Fig. 4) were generated. The oligonucleotides used for each PCR employed in this series are listed in Table 1. Treatment to remove the N-terminal extension from each extended IA 3 polypeptide was carried out using the TAG- Zyme TM system, first described by Pedersen et al. [7], accord- ing to the manufacturer’s instructions (Qiagen, Crawley, UK). Briefly, this involved pretreatment of the DAPase TM (cathepsin C; 100 mU) with an equal volume of 20 mm cyste- amine-HCl for 5 min at room temperature, prior to mixing with 6 U (120 lL) of Q cyclase TM and samples of 1–1.5 mg of each purified, N-terminally tagged recombinant IA 3 . This mixture was incubated at pH 7.0 in the presence of 5 m m EDTA to chelate any free Ni 2+ ions. After 2 h at 37 °C, DAPase TM and Q cyclase TM , which are both C-terminally His-tagged, were removed, together with any residual IA 3 protein with intact tag by absorption onto a nickel-nitrilotri- acaetic acid agarose column, equilibrated in 20 mm sodium phosphate buffer, pH 7.0 ⁄ 150 mm NaCl. Flow through fractions (usually 8 · 0.9 mL) were pooled, concentrated by centrifugation in a Vivaspin-2 spin concentrator fitted with a 3000 Da molecular mass cut-off membrane (Vivascience, Sartorius, Epsom, UK) and the released dipeptide fragments were removed by gel filtration on a Sephadex G-25 column, equilibrated in 25 mm sodium phosphate buffer, pH 6.5 containing 50 mm NaCl. Fractions containing trimmed IA 3 Table 1. Construction of mutant forms of IA 3 from S. cerevisiae and S. castellii. The indicated pairs of forward (F) and reverse (R) oligonucle- otide primers were used to introduce the desired changes in S. castellii or S. cerevisiae IA 3 , thus generating each of the identified variants. Identity Oligonucleotide sequences (5¢ to 3¢) 3 (F) CTAGCTAGCCCTGAAAGTAAGGAAAAAATGAAGAC (R) CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG 5 (F) GGAATTCCATATGAGTGATAAAAACGCTAACGTC (R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC 11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC 12 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC 13 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTAATACGAATCTTGAGCTTTCTTTTC 14 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTATTTTGTCTTCATTTTTTCCTTACTTTC 15 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC 16 (F) GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG (R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC newpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCA newpetBOT TATGGTGGTGGTGGTGGTGGTGTTTCATAAGCTTATCTCCTTCTTAAAGTTAAACAAAATTATTT T. J. Winterburn et al. N-terminal extension of IA 3 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3693 were identified by SDS ⁄ PAGE, pooled and concentrated, if necessary, in a Vivaspin concentrator as above. In this way, inhibitors 11T, 14T, 15T and 16T were generated from their respective parents 11, 14, 15 and 16. Synthetic peptide forms of IA 3 (inhibitors 4, 6–10) were obtained from Alta Biosciences (Birmingham, UK) and contained l-norleucine residues in place of methionine, where appropriate, as described previously [1–4]. Inhibition assays were performed at pH 4.7 as described previously [1–3]. The chromogenic peptide substrate used was Lys- Pro-Ile-Glu-Phe*Nph-Arg-Leu (where the scissile peptide bond is indicated by the asterisk and Nph represents l-nitrophenylalanine) and was purchased from Alta Bio- sciences. N-terminal sequencing was performed by automa- ted Edman degradation (Alta Biosciences). Samples for amino acid analysis were hydrolysed in vacuo for 24 h at 110 °Cin6m HCl. No attempt was made to correct the values obtained for methionine to include the products of oxidation, methionine sulfoxide and methionine sulfone. MALDI-TOF mass spectrometry was performed at the University of Dundee ‘Fingerprints’ Proteomics Facility, UK. MALDI mass spectra were generated using a Voyager DE-STR MALDI-TOF MS system (Applied Biosystems, Foster City, CA, USA) with delayed extraction in positive ion reflectron mode. Samples (diluted to a final concentra- tion of 2 pmolÆ l L )1 ) were applied to a MALDI sample plate and supplemented with 1.0 lLofa5mgÆmL )1 solu- tion of a-cyano-4-hydroxy-trans-cinnamic acid matrix (Sig- ma, Poole, UK) plus 10 mm ammonium di-hydrogen phosphate in 50% (v ⁄ v) acetonitrile in 0.1% (v ⁄ v) trifluoro- acetic acid, mixed and allowed to air dry prior to analysis. The mass spectrometer was internally calibrated using a matrix ion at 568.13 Da and mass measurement accuracy was typically ± 0.01%. The resultant data were analysed using the massXpert computer program [8]. Modelling calculations were carried out on an SGI Octane work- station (Silicon Graphics, Geneva, Switzerland) with dual R12000 processors, using the moloc program (Gerber Molecular Design, Amden, Switzerland), as reported pre- viously [1,4]. Acknowledgements Supported by awards (to J.K.) from the UK Biotech- nology and Biological Sciences Research Council (grant numbers 72 ⁄ C13544 and 72 ⁄ 0014846). We are very grateful to our colleagues Jakob Winther and Anette Bruun (formerly of the Carlsberg Laboratory, Copenhagen, Denmark) for help with production of recombinant PpPr; to John Fox, Alta Biosciences, Bir- mingham, for provision and analysis of synthetic pep- tide variants of IA 3 ; and to Doug Lamont and Kenny Beattie, University of Dundee, for carrying out mul- tiple mass spectrometry analyses of the IA 3 variants. The endless patience, tolerance and skill of Marian Williams in the production and revision of the manu- script is hugely appreciated. References 1 Winterburn TJ, Wyatt DM, Phylip LH, Bur D, Harrison RJ, Berry C & Kay J (2007) Key features determining the specificity of aspartic proteinase inhibition by the helix-forming IA3 polypeptide. J Biol Chem 282, 6508– 6516. 2 Phylip LH, Lees WE, Brownsey BG, Bur D, Dunn BM, Winther JR, Gustchina A, Li M, Copeland T, Wlodawer A & Kay J (2001) The potency and specificity of the interaction between the IA 3 inhibitor and its target aspar- tic proteinase from Saccharomyces cerevisiae. J Biol Chem 276, 2023–2030. 3 Li M, Phylip LH, Lees WE, Winther JR, Dunn BM, Wlodawer A, Kay J & Gustchina A (2000) The aspar- tic proteinase from Saccharomyces cerevisiae folds its own inhibitor into a helix. Nat Struct Biol 7, 113–117. 4 Winterburn TJ, Wyatt DM, Phylip LH, Berry C, Bur D & Kay J (2006) Adaptation of the behaviour of an aspartic proteinase inhibitor by relocation of a lysine residue by one helical turn. Biol Chem 387, 1139–1142. 5 Ganesh OK, Green TB, Edison AS & Hagen SJ (2006) Characterizing the residue level folding of the intrinsically unstructured IA 3 . Biochemistry 45, 13585–13596. 6 Green T, Ganesh O, Perry K, Smith L, Phylip LH, Logan TM, Hagen SJ, Dunn BM & Edison AS (2004) IA 3 , an aspartic proteinase inhibitor from Saccharomyces cerevisiae, is intrinsically unstructured in solution. Bio- chemistry 43, 4071–4081. 7 Pedersen J, Lauritzen C, Madsen MT & Dahl SW (1999) Removal of N-terminal polyhistidine tags from recombi- nant proteins using engineered aminopeptidases. Protein Expr Purif 15, 389–400. 8 Rusconi F & Belghazi M (2002) Desktop prediction ⁄ analysis of mass spectrometric data in proteomic projects by using massXpert. Bioinformatics 18, 644–645. N-terminal extension of IA 3 T. J. Winterburn et al. 3694 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS . N-terminal extension of the yeast IA 3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity Tim J. Winterburn 1 ,. contacts that are made outwith the active site of the enzyme. The effect of removal of the N-terminal extension The full N-terminal extension sequence, MK(H) 7 MQ, was