báo cáo khoa học: " Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report" pptx

... article as: Fritzsche et al.: Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report. Journal of Medical Case Reports 2010 4:3 74.Submit ... contributionsTF and SK analyzed the clinical and radiological data. FRF and PKB analyzed and interpreted the pathological data. TF and FRF wrote the main parts of the manuscript. All authors read and approved ... Kawashima A, Sandler CM, Fishman EK, Charnsangavej C, Yasumori K,Honda H, Ernst RD, Takahashi N, Raval BK, Masuda K, et al: Spectrum of CT findings in nonmalignant disease of the adrenal gland....

Báo cáo khoa học: "Clinical and pathological assessment of different suture techniques for microvascular anastomosis in rat femoral artery" ppsx

... ...

Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx

... content of acorns and the exploitation of starchreserves at germination decreased with increasing duration of storage. Ageing processes are prob-ably impairing the availability ... laboratoryfrost-hardiness test were run for about 20 daysat specific temperatures.The great variability within the acorn popula-tion contrasted with a variance-analytical inter-pretation ... This aim failed because of fungal invasion but, nevertheless, it waspossible to assess the physiological and pathological aspects of acorn ageing.Although thermotherapy was...

Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

... desaturases from M. alpina,whereasinthecaseofC. elegans or man, each pair of front-end desaturasesformed a separate branch (data not shown). This may indi-cate that the D5- and D6-desaturases from P. ... gel separation, DNA moleculeslarger than 300 bp were ligated into vector arms and packaged into lambda ZAP Express phages using theGigapack Gold Kit (Stratagene, Amsterdam, Netherlands).Random ... gram-scalepuriﬁcation of this particular PUFA has already beenachieved [9]. Very long chain PUFAs like EPA, DHA and arachidonic acid (ARA, 20:4D5,8,11,14) have received greatinterest as such fatty acids are...

Báo cáo khoa học: "Prevalence and associated factors of physical fighting among school-going adolescents in Namibia" pptx

... while a response of ≥1 was classified as having engaged in a phys-ical fight. Data analysis was performed using SUDAANsoftware (Research Triangle Institute, Durham, NC, USA,version 9.0). A weighting ... estimate may also allow cross-country comparisons regarding the prevalence of healthbehaviours and associated factors.MethodsOur study involved secondary analysis of existing dataavailable from ... proportion of 13 year olds thatreport engaging in bullying once a week ranges from 1.2% in England and Sweden and 7.6% in the United States to9.7% in Latvia [4]. Lai-Kah et al. reported that in 2001,27.9%...

báo cáo khoa học: " Psychosocial and contextual correlates of opioid overdose risk among drug users in St. Petersburg, Russia" pot

... overdoses and arrived in a median of 20minutes (range 5 – 60). Naloxone was administered in five cases (22.7%), two of which did not involve a requestfor an ambulance.Variables associated with having ... the final manuscript.AcknowledgementsFunding for this study was provided by NIH/Fogarty International Center as part of the International Clinical Operational and Health Services Research and ... performing data analyses, and writing the manuscript. TCG participated in develop-ing the study design, helping to create the study instru-ments, performing data analyses, and writing themanuscript....

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... University of Alabama at Birmingham, Birmingham, Alabama, USA and 5Vinnitsya National Medical University – Pirogov, Vinnitsya, UkraineEmail: Kostyantyn V Dumchev - k.dumchev@gmail.com; Ruslan Soldyshev ... study and participated in design, datacollection, statistical analyses, and interpretation of results and led drafting of the manuscript. JS participated in study design and interpretation of results ... findings add to Booth's HIV prevalence find-ings of 34% in Kiev (major metropolitan area), 51% in Odessa (southern seaport), and 17% in Makeevka/Donesk (eastern mining region) in Ukraine...

Báo cáo khoa học: "Lameness and Claw Lesions of the Norwegian Red Dairy Cattle Housed in Free Stalls in Relation to Environment, Parity and Stage of Lactation" pps

... Corkscrewedlateral hind claws included both mild caseswhere the abaxial wall was bent inwards with a curved dorsal border and serious cases of corkscrew claws where the abaxial wall waspart of the ... Effects of conformation and manage-ment system on hoof and leg diseases and lame-ness in dairy cows. In: Veterinary Clinics of NorthAmerica: Food Animal Practice (ed. AndersonD). Saunders, Philadelphia, ... mod-els as well as adaptation period and days at pas-ture. ResultsLameness, claw lesions, carpal and tarsal remarksFront limb lameness was recorded in 0.3% and hind claw lameness in 1.6% of the...

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank underaccession numbers 2xog and 2xoiAbbreviationsPDB, Protein Data Bank; ... &Mazzarella L (1998) Binding of a substrate analog to a domain swapping protein: X-ray structure of the com-plex of bovine seminal ribonuclease with uridylyl-(2¢,5¢)-adenosine. Protein ... dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department of Biology and Biochemistry, University of Bath, UK2 Department of...

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D ... AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation of cytosolic 5¢-nucleotidase R. Pesi et al.4870 ... GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG...

Xem thêm