báo cáo khoa học: "Rapid self-assembly of DNA on a microfluidic chip" docx

... University of Alberta, Edmonton, Alberta, CanadaEmail: Yao Zheng - zheng@ualberta.ca; Tim Footz - tfootz@ualberta.ca; Dammika P Manage - manage@ece.ualberta.ca; Christopher James Backhouse* ... information upon the dynamics of the self-assembly process.BackgroundThere has been a rapid growth in the number of applica-tions that are based upon DNA self-assembly, rangingfrom DNA microarrays ... rapidinvestigation of self-assembly mechanisms. In addition,this re-hybridisation enables the formation of duplexesmade from a sample and a set of DNA references – i.e. DNA self-assembly within a microchip...

Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx

... which such a dictionary algo- rithm is necessary. Indexing and searching of databases consisting of unformatted natural language text is one such application. The proliferation of personal comput- ... a parallel dictionary is to seri- ally broadcast all of the words in a given set. Processors that contain a broadcast word check off the appropriate status bits. When all of the words in one ... operate on graphs, and in particular on linked lists that contain natural, language text. 8.3 Application of Scan and Sort to Dic- tionary Lookup To combine these two modules into a dictionary,...

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... transcriptional activation andrepression, regulation of alternative splicing, regula-tion of mRNA stability, translational activation orrepression and RNA packaging. It was also shownrecently that a Y-box ... Schnuchel A, Holak TA &Marahiel MA (1995) Mutational analysis of the puta-tive nucleic acid-binding surface of the cold-shockdomain, CspB, revealed an essential role of aromaticand basic residues ... sheet of one chain assembles with a second b sheet from a dif-ferent chain and vice versa. The swapped chains canbe interrelated by a noncrystallographic twofold rota-tion axis. The functional...

Báo cáo khoa học: Distinctive activities of DNA polymerases during human DNA replication ppt

... 206,43–48.61 Hiraga S-I, Hagihara-Hayashi A, Ohya T & Sugino A (2005) DNA polymerases alpha, delta, and epsilonlocalize and function together at replication forks inSaccharomyces cerevisiae. Genes ... cycle arrest at the initia-tion step of human chromosomal DNA replicationcauses DNA damage. J Cell Sci 17, 4897–4908.44 Nakamura H, Morita T, Masaki S & Yoshida S (1984)Intracellular localization ... S-phase pro-gression and DNA replication, rather than a DNA repair or damage response function. Furthermore, thepolymerase trap and inhibition of replication in isolatednuclei are both functions...

Báo cáo khoa học: "Rapid measurement of trunk MOE on standing trees using RIGIDIMETER" docx

... stress wave propagation method and its application. IV. Application to qua-lity evaluation of hinoki (Chamaecyparis obutusa) forests, Mokuzai Gakkais-hi/Journal of the Japan Wood Research Society, ... felled and remeasured. The goal of this study was to contri-bute to the validation of the Rigidimeter, as a fast non-destructive and reliable tool for rapid evaluation of MOE, an important mechanical ... period.2.3. Causes of measurement imprecision2.3.1. Taper and crookednessMeasurement imprecision comes primarily from variation of thesecond moment of area I, on which are based the above relation-ships....

Báo cáo khoa học: "Rapid detection of pneumothorax by ultrasonography in patients with multiple trauma" pptx

... small orit is a locally separated one. When the patient is in a supineposition, a small pneumothorax usually locates in the antero-apical or antero-basal space [20]. As a result, examination ... from a car accident, and arrived with dyspnea, tachycardia, hypotension and desaturation requiring mechanical ventilation. (a) The supine chest radi-ograph did not enable a diagnosis of pneumothorax. ... Surgeon-per-formed ultrasound for pneumothorax in the trauma suite. JTrauma 2004, 56:527-530.18. Hoff WS, Holevar M, Nagy KK, Patterson L, Young JS, Arrillaga A, Najarian MP, Valenziano CP: Practice management...

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... cellular model of Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1,Giovanna Tosi3, Leonardo Lopiano4and ... Pro transmis-sion scanner (Epson, Nagano, Japan) and analyzed withimagemaster 2d platinum software, version 5.0 (GEHealthcare). Spots were detected automatically by the soft-ware and manually ... plasmid containing human a- synuclein cDNA (a- syn). As a control, we usedSH-SY5Y cells stably transfected with the plasmidcontaining b-galactosidase cDNA (b-gal). Western blotanalysis revealed...

Tài liệu Báo cáo khoa học: Reductive nitrosylation of ferric human serum heme-albumin docx

... Bhattacharya AA,Zunszain PA, Ghuman J, Bhagavan NV & Curry S(2003) Structural basis of albumin-thyroxine interac-tions and familial dysalbuminemic hyperthyroxinemia.Proc Natl Acad Sci USA, 100, ... Crystallo-graphic analysis reveals common modes of binding of medium and long-chain fatty acids to human serumalbumin. J Mol Biol, 303, 721–732.18 Petitpas I, Bhattacharya AA, Twine S, East ... Alessandra di Masi1, Francesca Gullotta1, Giampiero De Sanctis4,Gabriella Fanali5, Mauro Fasano5and Massimo Coletta3,61 Department of Biology, University Roma Tre, Italy2 National Institute...

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... active site. Thus, the conformational switch of the a2 -helix could be of functional relevance and beassociated with either an ‘open’ nonfunctional confor-mation or a ‘closed’ conformation adopted ... three-stranded b-sheets, each one consisting of the antiparallel b-strands b6, b7 of one monomer andstrand-b8 of the other. Solvent-accessible surface [15]calculations show that a substantial area, ... 1UAN), the equivalent Aspresidues (Asp15 and Asp12, respectively), adopt a mainchain conformation that deviates less from the stand-ard values. It appears that the presence of a functional(i.e....

Xem thêm