báo cáo khoa học: " A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report" docx
báo cáo khoa học: " A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report" docx
... JOURNAL OF MEDICAL CASE REPORTS A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case reportAhmed et al.Ahmed et al. Journal of Medical Case Reports ... 5:450http://www.jmedicalcasereports.com/content/5/1/450 (12 September 2011)CAS E REP O R T Open Access A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case reportSaad Ahmed1*, ... case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report. Journal of Medical Case Reports 2011 5:450.Submit your next manuscript to BioMed Central and take...
- 5
- 291
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAACPhe554 fi Ala forward GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTCPhe554 fi Ala reverse GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTCAsn555 fi Ala forward TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTCAsn555 ... 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢(Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCACGAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAACCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTAGCCTGAACCGCCGAT (Trp551 fi Ala ⁄ Phe554 ... CCTCGTCCTGCCGCCTCCAATGCTCTGGAPhe692 fi Ala reverse TCCAGAGCATTGGAGGCGGCAGGACGAGGPhe700 fi Ala forward GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGCPhe700 fi Ala reverse GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGCPhe718 fi Ala...
- 15
- 337
- 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... modeled.Table S4. Average rmsd (A ˚) for the conserved catalyticresidues calculated from MD simulations of a- CT and the various Lac -a- CT conjugates modeled.This material is available as part of the ... mechanism of the enzyme.Structural insights into the mechanochemicalnature of a- CT catalysis A more detailed analysis of the influence of chemicalglycosylation on the dynamics of a- CT from the ... slow and stable amide protons and kHX,1 and kHX,2are the apparentexchange rate constants for the fast and slow amide pro-tons. Results were interpreted thermodynamically under the EX2exchange...
- 17
- 531
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... 2002side-chain at residue 210 is dispensable, as shown by the factthat H21 0A and H210S are as active as native API withVLK-MCA as a substrate (Table 1). This means thatTrp169 does not play a role as ... by the Trp169–His210 stacking, suggesting thatAPI has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytictriad.ACKNOWLEDGEMENTWe are grateful ... In the struc-tural deviation, the solvent ASA of the side-chain of His210increased with the decrease in size of the side-chain atresidue 169 (Table 1 and Fig. 3A) . However, the ASAs of Asp113...
- 7
- 603
- 0
Báo cáo khoa học: Secondary structure of lipidated Ras bound to a lipid bilayer pptx
... of Ras at the air–waterinterface was analysed. With the largely increasedsignal -to- noise ratio of ATR-FTIR, we have, for the Table 1. X-Ray and NMR-based secondary structure of Ras in comparison ... dithiothrei-tol and 0.1 mm GDP at pD 7.8. Protein adsorption on to the membrane was followed by the evolution of the amide I and II (amide I¢ and II¢ in the case of deuterated buffer)bands. The measurements ... parameter set (number of bands and positions,FWHHs and Gaussian ⁄ Lorentzian fractions for each band)was then used to decompose the amide I band of membrane-bound Ras, where only the peak...
- 9
- 484
- 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... parasiticprotozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsisthaliana [14].MGL has been implicated in the degradation of toxic SAAs [15], and ... Parasitol 147, 163–176.36 Sato D, Yamagata W, Kamei K, Nozaki T & Harada S(2006) Expression, purification and crystallization of L-methionine gamma-lyase 2 from Entamoeba histolyti-ca. Acta ... min, and the amount of a- keto acid was measured. The means for the triplicate measurements of the amount of a- keto acids produced after the addition of 2 mMMet are plotted. Error bars are omitted...
- 13
- 406
- 0
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt
... stop TCTfiCCT + CAAfiTAA Between the N-terminal regulatory domain and TMD1K250E AAAfiGAA Between the N-terminal regulatory domain and TMD1G348D GGTfiGAT Loop BG348R GGTfiCGT Loop BG348S GGTfiAGT ... is an atypical aquaglyceroporin as the highlyconserved NPA motifs in the B- and the E-loop are NPS(Asn-Pro-Ser) and NLA (Asn-Leu-Ala), respectively,sequences that are also found in the Plasmodium ... forsuppressors of truncated, hyperactive Fps1 and obtainedmutations that reduced transport. The four mutants char-acterized faced the outside of the cell [15]. Structural analysis of AQP1 and GlpF...
- 9
- 383
- 0
Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf
... Linguistics Automatic Part -of- Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario Sandipan Dandapat, Sudeshna Sarkar, Anupam Basu Department of Computer ... described here are very simple and efficient for automatic tagging even when the amount of available annotated text is small. The models have a much higher accuracy than the naïve baseline model. ... for the unknown words. If the word is unknown to the morphological analyzer, we assume that the POS-tag of that word belongs to any of the open class grammatical categories (all classes of...
- 4
- 455
- 0
báo cáo khoa học: " Retailers’ knowledge of tobacco harm reduction following the introduction of a new brand of smokeless tobacco" pps
... Canada because of the near prohibition on the manufacturers’ ability to communicate health information to their customersother than in-person at the point of sale, and restric-tions on the right ... briefings and written materials aboutdMS.Inaddition,wetookadvantageofthestudytoalso examine compliance with recommendations regard-ing the sale of tobacco t o young adults. According to recommendations ... askquestions about THR as part of a conversation aboutdMS, and attempt to purchase dMS. The dMS refrigera-tor was often near the cash register, allowing for a visualreference to the product. The researchers...
- 7
- 314
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ