báo cáo khoa học: "Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study" doc

... residual diseaseFigure 3 TEL-AML1 fusion as a minimal residual disease. Kap-lan-Meier curve for the persistence of TEL-AML1 fusion as a minimal residual disease (MRD) as a predictor of overall ... Satake N, Sakashita A, Kobayashi H, Maseki N, Sakurai M, Kaneko Yl: Minimal residual disease with TEL-AML1 fusion transcript in childhood acute lymphoblastic leukemia with t(12;21). Br JHaematol ... if CD 10 positive B-ALL immunophenotype will have a similarly high inci-dence of positive TEL-AML1 fusion gene? . Accordingly canwe use this fusion gene as a minimal residual disease (MRD) in...

Báo cáo khoa học: Pharmacology of vascular endothelium Delivered on 27 June 2004 at the 29th FEBS Congress in Warsaw pptx

... transporter. Clinical data on ADMA aregrowing. A high plasma level of ADMA is considered a novel cardiovascular risk factor. Nowadays, it isclear that ADMA contributes to vascular pathology in atherothrombotic ... kininase 2) inhibitors; ADMA, asymmetric dimethylarginine; ASA,acetylsalicylic acid; BH4, tetrahydrobiopterin; Bk, bradykinin; BPF, bradykinin potentiating factor; CAD, coronary heart disease; CaM,calmodulin; ... bovine aorticendothelial cells lipophylic statins, i.e. atorvastatin,simvastatin and lovastatin (but not a hydrophilicpravastatin) at a concentration of 30 lm mobilize freecytoplasmic calcium...

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... previously known as a seed albumin [5], it was named PA1b for pea albumin 1b.PA1b is the result of the post-translational cleavage of thealbumin proprotein PA1, also releasing a second peptide(PA 1a) . ... time are enzyme inhibitors (including for exampletrypsin, a- amylase and carboxypeptidase) [18]. PA1b is of plant source, but all inhibitory assays conducted until now has failed to detect any ... reaction was stoppedby adding 10 lgoftyrosinein140lLofwater.Theradiolabeled peptide was separated from non-incorporatediodine by reverse-phase HPLC. In these conditions, incor-poration of...

Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

... cocktail (Quick-safe A, Zinsser Analytic, Frankfurt/Main, Germany).The radioactivity was quantified in a Canberra-PackardTricarb-2500 counter. The kinetic constants of transportwere estimated ... proteins acting as sensors it has been shown thatinsertional mutations led to constitutive induction [11,22]. In case of the mutated bacterial iron transporter FecA it has been postulated that ... its affinity for Glc6P as aninducer; this is seen most dramatically in R149C in whichthe affinity for Glc6P as the transport substrate increasedtwofold and that for Glc6P as the inducer decreased...

Báo cáo khoa học: Regulation of Cyr61/CCN1 gene expression through RhoA GTPase and p38MAPK signaling pathways Role of CREB and AP-1 transcription factors doc

... phosphorylationstate is determined by the level of activity of a myriad of signaling cascades that leads to the activation of CREBkinases such as PKA, RSK, calmodulin kinase andMSK1/2. It was suggested that ... induced a rapid increase in the amount of the active GTP-bound form of RhoAculminating in a sixfold increase after 5 min. S1P effects onRhoA activation was sustained for up to 15 min and did notalter ... weremediated through various protein kinase and monomericGTP-binding protein signaling pathways including MAPkinases and Rho GTPases [18,20,31]. To determine thesignal transduction pathways that...

Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx

... CTTGGCTGCTTGCGAGCTGTTATTCTTTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAACAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACAGAACTGGTATCAAAGATGAGAGAAATG; LmA105S(R), CATTTCTCTCATCTTTGATACCAGTTCTGTCAA;LmT9 4A (F), CAAGCTGGAGTCGGCGCAATATTTGACAGAGTTTTG; ... CTCGAGAACCATGGAAGACGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAACAATGGAAGACGCCAAAAACATAAAG. The boldletters in the primers show Kozak sequence.The luciferase reporter gene with the Kozak sequence wasthen ... CAGATCGATGTGAAAATGATGCAATTAGCAGTTC; Lm V123I (F), TGGCTGCTTGCGATCTATTATTCTTTTCAATCC; Lm V123I(R), GGATTGAAAAGAATAGATCGCAAGCAGCCA.Screening of LmRXR mutants in tobaccoprotoplastsThe LmRXR mutants...

Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx

... factor characterizing activity of ATP synthase in a particularmitochondrial preparationEstimated on the basis of ﬁtting of the model against our datanSYN3H+⁄ ATP ratio [65]v 0.9 Parameters ... phosphorylation rate than the increase of electric potential and corresponding increase in ATP–ADP steady-state exchange rate mediated by the ANT. As also seen in Fig. 3, the calculated values of the ... are: (a) the value characterized by theactivity of ATP synthase (cSYN); and (b) the value characterized by the amount of ANT (cANT) for a given tissue. These parameters characterize a particularsuspension...

Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

... study are listed in Table 1. Plasmid pCJ31B contains the L. lactis pyrG gene, and was made from a PCR-product made with prim-ers pyrG1 1a (5¢-GTAGAAGCTAAAATCTGG-3¢)andSLLH7 (5¢-TACAAAAGATTTTGGGC-3¢) ... 2.5-fold and that the average in vivo activity of CTP synthase is correspondingly increased. Increased in vivo activity of CTP synthase may be due to the reducedCTP concentration, as the L. lactis ... reaction [8]. CTP synthase has a central role in pyrimidine metabolism, as the enzymecatalyses the only reaction resulting in the amination of the pyrimidine ring into a cytosine derivative (Fig. 1)....

Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebraﬁsh genome by subfunctionalization of tissue-speciﬁc expression doc

... aa 60 aa 38 aa 16 aa5828 bp 3262 bp23 aa 60 aa 38 aa 16 aa7629 bp 6815 bp 7470 bp23 aa 60 aa 38 aa 16 aa1959 bp 3453 bp 1222 bp23 aa 60 aa 38 aa 16 aa554 bp 2277 bp 4313 bp23 aa 60 aa ... hind-brain and spinal cord from early stages of embryogenesis. crabp 1a mRNAwas detected in the forebrain and midbrain at later developmental stages. In adult zebraﬁsh, crabp 1a mRNA was localized ... (crabp1b;3¢-RACE:5¢-GCTAACAGATCAATAGGCTTC-3¢,5¢-GATTTGAAAGCAAGAGGGTC-3¢;5¢-RLM-RACE: 5¢-TTAGACGCAGCCGCACAAG-3¢,5¢-CGGCCATCGACGGTCTC-3¢).Three 3¢-RACE cDNA and 5¢-RLM-RACE clones of each gene were...

Báo cáo khoa học: Inhibition of urokinase receptor gene expression and cell invasion by anti-uPAR DNAzymes in osteosarcoma cells pot

... 5¢-GTCACCACAGGCTAGCTACAACGACCAGGCACT-3¢Dz483 (mutant) 5¢-ACACCACTGGGCTAGCTACAACGATCACGGACC-3¢ 483 ntDz720 (active) 5¢-GAGCATCCAGGCTAGCTACAACGAGGGTGCTGT-3¢Dz720 (mutant) 5¢-TAGAGCCACGGCTAGCTACAACGATTGGCGTGG-3¢ ... serineprotease family, which includes plasmin and urokin-ase-type plasminogen activator (uPA), has been identi-ﬁed as being involved in the metastatic process. In a clinical setting, members of the ... proteindecreases at a faster rate as the result of existinguPAR mRNA cleavage.Regardless of the efﬁciency of cleavage, one of themajor challenges facing the future application of DNAzymes in a clinical...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM