Báo cáo y học: "Effect of a structurally modified human granulocyte colony stimulating factor, G-CSFa, on leukopenia in mice and monkeys" docx
Báo cáo y học: "Effect of a structurally modified human granulocyte colony stimulating factor, G-CSFa, on leukopenia in mice and monkeys" docx
... of a structurally modified human granulocyte colony stimulating factor, G-CSFa, on leukopenia in mice and monkeysYongping Jiang1, Wenhong Jiang1, Yuchang Qiu1 and Wei Dai2*AbstractBackground: ... proteinpurification experiments and was involved in data acquisition, analysis and interpretation. WJ conducted in vitro experiments including proteinpurification and analysis. WD was involved in the analysis ... colony stimulating factor, G-CSFa, on leukopenia in mice and monkeys. Journal of Hematology & Oncology 2011 4:28.Submit your next manuscript to BioMed Central and take full advantage of: ...
- 8
- 319
- 1
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... (RA) is a chronic inflammatory diseasethat affects nearly 1% of the population worldwide and canlead to significantly impaired quality of life. Mortality rates arealso significantly increased ... that DHMEQ inhibits TNF-α-induced nuclear translo-cation of NF-κB, and does not inhibit phosphorylation and degradation of IκB, or a c-Jun N-terminal kinase (JNK) and a caspase-activating pathway ... features of RA.Notably, the efficacy of these biologic agents has indicatedthat intervention in a single cytokine pathway can achieve sig-nificant suppression of the complex inflammatory network and ameliorate...
- 12
- 459
- 0
Báo cáo y học: "Effect of a lung recruitment maneuver by high-frequency oscillatory ventilation in experimental acute lung injury on organ blood flow in pigs" ppsx
... and PCV.Transpulmonary pressure, pulmonary gas exchange, and pulmonary shuntAll ventilatory parameters, PaO2 and PaCO2, and calculatedpulmonary shunt fraction data are presented in Table ... recommendations of the Report of the Amer-ican Veterinary Medicine Association Panel on Euthanasia)Table 1Ventilatory parameters, hemodynamics, and blood gas analysis before and after induction of ... stepwise increase of Pmean, starting at 20 mbar, followedby 25 and 30 mbar. To maintain normocapnia at a Pmean level of 30 mbar, increased oscillatory pressure amplitudes (Table2) during HFOV and...
- 10
- 325
- 0
Báo cáo y học: "Effect of a lung recruitment maneuver by high-frequency oscillatory ventilation in experimental acute lung injury on organ blood flow" pdf
... and PCV.Transpulmonary pressure, pulmonary gas exchange, and pulmonary shuntAll ventilatory parameters, PaO2 and PaCO2, and calculatedpulmonary shunt fraction data are presented in Table ... recommendations of the Report of the Amer-ican Veterinary Medicine Association Panel on Euthanasia)Table 1Ventilatory parameters, hemodynamics, and blood gas analysis before and after induction of ... level of anesthesia was monitored clinicallyby observation of the heart rate and the blood pressure.The trachea was intubated and the lung was mechanically ven-tilated via an endotracheal tube...
- 10
- 385
- 0
Báo cáo y học: "Effect of a short-term HAART on SIV load in macaque tissues is dependent on time of initiation and antiviral diffusion" pot
... USA).Plasma and cell-associated viral load as well as SIV-RNA,total SIV-DNA and 2LTR SIV-DNA were compared in placebo and HAART-treate d macaques using a nonpara-metric Mann-Whitney test. ... vaginal transmission of the samevirus, probably because of initial viral compartmentali-zation and low dissemination [29] in association withgood diffusion of NRTI in the female genital tract ... combination (HAART d7-d21: black symbol) for 14 days and were killed at the end of treatment (21 days pi). Initiation of HAART 7 days after SIV infection conducts to a significant decrease of...
- 11
- 336
- 0
Báo cáo y học: "Effect of a heated humidifier during continuous positive airway pressure delivered by a helmet" pot
... was approved by the institutionalreview board of our hospital and informed consent wasobtained in accordance with Italian national regulations.InterfaceThe helmet (Castar, Starmed, Modena, ... humidifying capability of the respiratory tract may also beinfluenced by the presence of airway or pulmonary disease[26-28].The aim of this study, conducted in patients with acute respi-ratory ... acute respiratory failure and healthy individuals with and without heated humidifier. Shown are average ratings of com-fort in (a) patients with acute respiratory failure and in (b) healthy...
- 8
- 267
- 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... toCRF2receptors. A combination of an aromatic with a heteroaromatic ring at the N-terminus increases thebinding affinity of antisauvagine-30 analogs to CRF2butalso CRF1receptors.At high concentration ... noteworthy that theN-terminal amino acidD-Phe in antisauvagine-30 can bereplaced by a phenyldiazirine,L-Tyr orD-Tyr [37] residuewithout diminishing the binding affinity of the ligands toCRF2receptors. ... Lucia,Australia A novel photoactivatable analog of antisauvagine-30 (aSvg-30), a specific antagonist for corticotropin-releasing factor(CRF) receptor, type 2 (CRF2), has been synthesized and characterized....
- 7
- 344
- 0
Báo cáo y học: " Failure of a non-authorized copy product to maintain response achieved with imatinib in a patient with chronic phase chronic myeloid leukemia: a case report" ppsx
... main-tenance of response is of utmost importance. A copy preparation, consisting of the alpha crystal form of imatinib, has become commercially available under thename ‘imatib’ (CIPLA-India) at a markedly ... performed. In May 2007, the patient resumed imatinib at a daily dose of 600 mg per day. In July 2007, after approximately twomonths of therapy with imatinib, laboratory valuesrevealed a return to a ... hematologic and cytogeneticresponse and in November 2007, after six months of therapy, the patient achieved a %BCR-ABL/ABL score of 0.01. Changes in hematologic laboratory parameters atbaseline,...
- 3
- 209
- 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
... the in vivo and cellular assays and analysis and interpretation of data, EJM, MW and CL participated in the design of thestudy and analysis and interpretation of data. HB conceived of the study,participated ... sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3Positive ... sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested...
- 11
- 348
- 0
Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx
... super syringetechnique.Variables were expressed as mean ± standard deviation. A two-way analysis of variance (ANOVA) for repeated measureswas conducted to study the effects of time and PV measure-ment ... PVCF.Conclusion Evaluation of the effects of a strategy aimed atimproving oxygenation can be reliably recorded early after a single PV measurement that is not followed by a change in PEEP ... affect oxygenation in patients with acute respiratory distress syndromeAntoine Roch, Jean-Marie Forel, Didier Demory, Jean-Michel Arnal, Stéphane Donati, Marc Gainnier and Laurent PapazianService...
- 5
- 314
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ