0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "care management: A decision-makerresearcher partnership systematic review of effects on process of care and patient outcomes" docx

Báo cáo khoa học:

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... 5Research Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unitRob Shulman1, Mervyn Singer2, John Goldstone3 and ... criticallyrevising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis,interpretation and drafting the manuscript.AcknowledgementsTo the Medical ... cases,nurses administered medication without a legally valid physi-cian order. Although an absent 'signature' with CPOE wasregarded as an error, the audit facility of the Clinical Informa-tion...
  • 6
  • 525
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... similar to that in Asp141 of Met8P.The idea of NirF being a dehydrogenase is appealingbecause of the presence of a putative nucleotide-bind-ing motif in the N-terminal of the protein sequenceand ... to seek accu-mulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental ... the proximal axial ligand to the d1 heme. Replacement of an equivalent His, His41, in NirF byAla abolished binding of the heme to the protein. Known distal heme- binding residues, such as Met,...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity docx

Tài liệu Báo cáo khoa học: Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity docx

... MINIREVIEW Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity Constance Auvynet1,2,* and Yvonne Rosenstein11 Instituto de Biotecnologia, ... [13]. Cathelicidins killGram-positive and Gram-negative bacteria and Trypanosoma cruzi. Similar to defensins, cathelicidinsparticipate actively in linking innate and adaptive immunity and in modulating ... as in epithelial cellmigration, further suggesting a function for hBD2 in healing and protection of the intestinal epithelialbarrier [70].Proinflammatory and anti -in ammatory signalsof antimicrobial...
  • 12
  • 639
  • 0
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

... gagt … ccac ag GGATGT 1.43105 a TAACAG gt aata … ttcc ag ACGTAT 6.54 250 TATCTG gt atgt … taac ag GATATG 0.895120 ACGGAG gt aaaa … tccc ag CAACTC 1.76138 GTTTTG gt aaga … attt ag GGCAGT 0.527117 ... 7.74262 a TACTTG gt atgt … aatc ag GATATG 1.35120 a ACAGAG gt aaaa … tctc ag AAAATT 9.96 138 GCATTG gt aagg … attt ag GGCAGT 1.27117 CATTAT gt aagt … tttc ag GATATT 0.178160 TTGCAG gt ttgt … ttta ... ttta ag GTTCAA 1.29182 ATGGAC gt atgt … cata ag ATGTCC 3.810 994AAGGAC gt aagt … ttaa ag GATTGC 0.7011176 AGAAGA gt aagt … ttgc ag CAATTT 5.412130 ATGTTG gt aagt … tttt ag GGCATA 6.31385...
  • 9
  • 470
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH FARMING INDUSTRY IN THE MEKONG DELTA, VIETNAM " ppt

... group’ interviews at farmer association (aqua club) meetings using similar questions as 1 A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH ... within the catfish farming sector in the Mekong Delta ã Improved performance of BMPs in addressing social and environmental issues and overall sustainability of the catfish farming sector in the ... practical adoption of draft BMPs at pilot, commercial farm-scale in the hatchery, nursery and growout sectors of the catfish aquaculture industry in the Mekong Delta, Vietnam ã Monitor and evaluate...
  • 36
  • 414
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Fault Diagnosis Approach for Gears Based on IMF AR Model and SVM" pot

... faultsrespectively, it has been shown that the gear fault diagnosis approach based on IMF AR model and SVM can be appliedto classify the gear working conditions and fault patternseffectively and accurately even ... AR model can only be applied to stationarysignals, while the gear fault vibration signals always displaynonstationary behavior. To target this problem, in this paperbefore AR model is established, ... functions in common use are linearfunctions, polynomials functions, radial basis functions, and sigmoid functions.4. DIAGNOSIS APPROACH FOR GEARS BASED ON IMF AR MODEL AND SVMThe following autoregressive...
  • 7
  • 276
  • 0
báo cáo khoa học:

báo cáo khoa học: "The management of advanced oral cancer in a Jehovah''''s Witness using the Ultracision Harmonic Scalpel" docx

... formattedPDF and full text (HTML) versions will be made available soon. The management of advanced oral cancer in a Jehovah's Witness using the Ultracision Harmonic ScalpelWorld Journal of ... dose of 1 gram tranexamic acid and anaestethseia was induced with a combination of propofol (120mg), fentanyl (100mcg) and vecuronium (8mg). Anaesthesia was maintained using a remifentanil infusion ... Hoskin, P.J., et al., Effect of epoetin alfa on survival and cancer treatment-related anemia and fatigue in patients receiving radical radiotherapy with curative intent for head and neck cancer. ...
  • 18
  • 463
  • 0
báo cáo khoa học:

báo cáo khoa học: "Computerized clinical decision support systems for primary preventive care: A decision-makerresearcher partnership systematic review of effects on process of care and patient outcomes" pdf

... W Open AccessComputerized clinical decision support systems for primary preventive care: A decision- maker-researcher partnership systematic review of effects on process of care and patient outcomesNathan ... clinical decis ion support systems for primary preventive care: A decision- maker-researcher partnership systematic review of effects on process of care and patient outcomes. Implementation Science ... influenzavaccination for children and adolescents withasthma in primary care. 20* / /11,919Captured opportunities for vaccination and up-to-datevaccination rates (adjustedanalysis).0 Flanagan,1999[32]3...
  • 14
  • 484
  • 0
báo cáo khoa học:

báo cáo khoa học: "care management: A decision-makerresearcher partnership systematic review of effects on process of care and patient outcomes" docx

... for acute care; used anrandomized controlled trial (RCT) design where patient care with a CCDSS was compared to patient care without a CCDSS; assessed effects among healthcare professionalsin ... clinic al decision supportsystems for acute care management: A decision-maker-researcher partnership systematic review of effects on process of care and patient outcomes. Implementation Science ... the data; and drafted the manuscript. RL analyzed and interpreted data; and critically revised the manuscript. AR drafted themanuscript. JAM acquired, analyzed, and interpreted data; drafted...
  • 14
  • 568
  • 0
báo cáo khoa học:

báo cáo khoa học: "The counseling african americans to control hypertension (caatch) trial: baseline demographic, clinical, psychosocial, and behavioral characteristics" docx

... 13(2):106-111.doi:10.1186/1748-5908-6-100Cite this article as: Fernandez et al.: The counseling african americans to control hypertension (caatch) trial: baseline demographic, clinical, psychosocial, and behavioral characteristics. ... americans to control hypertension (caatch) trial: baseline demographic, clinical, psychosocial, and behavioral characteristicsSenaida Fernandez1, Jonathan N Tobin2,3, Andrea Cassells2, Marleny ... primary care practices. Demographic, clinical, psychosocial, and behavioral characteristics ofparticipants in the Counseling African American to Control Hypertension (CAATCH) Trial are described....
  • 13
  • 418
  • 0
báo cáo khoa học:

báo cáo khoa học: "Hybrid management of a spontaneous ilio-iliac arteriovenous fistula: a case report" ppsx

... presence of an abdominal bruit. Diagnosis, therefore, isoften incidental or delayed. Case presentation: We report a case of a spontaneous ilio-iliac arteriovenous fistula in a 68-year-old Caucasianman ... Zenia Martin, Naseem Haider, Mary P Colgan, Dermot Moore, Prakash Madhavanand Sean M O’NeillAbstractIntroduction: Spontaneous iliac arteriovenous fistulae are a rare clinical entity. Such localized ... aninteresting case of a high-output iliac arteriovenous fistulae successfully treated with a hybrid vascular approach.Introduction Spontaneous iliac arteriovenous fistulae (AVF) are a rareclinical entity....
  • 3
  • 301
  • 0
báo cáo khoa học:

báo cáo khoa học: " Successful management of refractory pleural effusion due to systemic immunoglobulin light chain amyloidosis by vincristine adriamycin dexamethasone chemotherapy: a case report" ppsx

... Access Successful management of refractory pleural effusion due to systemic immunoglobulin light chain amyloidosis by vincristine adriamycin dexamethasone chemotherapy: a case reportToshikazu Araoka1, ... use of vincristine, adriamycin and dexamethasone chemotherapy for refractory pleural effusion due to systemic immunoglobulin light chain amyloidosis without cardiac decompensation. Case presentation: ... JHaematol 2004, 125:681-700.doi:10.1186/1752-1947-4-322Cite this article as: Araoka et al.: Successful management of refractory pleural effusion due to systemic immunoglobulin light chain amyloidosis...
  • 5
  • 305
  • 0
báo cáo khoa học:

báo cáo khoa học: " Is untargeted educational outreach visiting delivered by pharmaceutical advisers effective in primary care? A pragmatic randomized controlled trial" pptx

... available data and itsprecise relationship to the clinical areas of interest.The routine use of educational outreach visiting by exist-ing pharmaceutical advisers, untargeted, may not be a worthwhile ... pre-scribed within a pragmatic evaluation of educational out-reach visiting by pharmacy advisers in a service setting.Table 1: Practice characteristics: number of GP partners in intervention and control ... is complicated by the fact that it is often evaluated as onepart of a multi-faceted package, incorporating additionalelements such as educational materials, educational meet-ings, or audit and feedback;...
  • 8
  • 160
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Occlusal management for a patient with aural symptoms of unknown etiology: a case report" pdf

... treatment of TMDs, occlusal equilibration was performed for a patient with aural symptoms (otalgia, tinnitus and vertigo) of unknown etiology in the right ear. An occlusal analysis was performed ... report Occlusal management for a patient with aural symptoms of unknown etiology: a case reportKengo Torii*1 and Ichiro Chiwata2Address: 1Torii dental clinic, 1-23-2 Ando, Aoi-ku, Shizuoka-shi, ... HOP and BPOP was significant using ananalysis of variance (ANOVA) for a two factor experiment with repeated measurements for both position factors (p< 0.005). An occlusal analysis was performed...
  • 4
  • 220
  • 0
báo cáo khoa học:

báo cáo khoa học: " Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana" docx

... CA). Gene specific primers with flankingattB sites were used to amplify the gene(5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAATGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTT-GTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGATCCTTG3'). ... inserts(5'AAAAACAAAAGCAGACATCGAC3' for sco1-2,5'GACCAAACAAAATCACAATAAG3' for sco1-3, and5'ATGAAACACGAGCTATATTGAG3' for sco1-4).Wild-type and all sco1 seed were sown on 1% agar ... Carlsbad,CA). A total of 50 nanograms starting RNA concentrationwere used in each reaction. SCO1 gene specific primersused for amplification were (For –5'AAAAACAAAAGCAGACATCGAC3') and...
  • 10
  • 464
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP