cáo khoa học: " Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A study protocol" ppsx
cáo khoa học: " Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A study protocol" ppsx
... 50:211-212.doi:10.1186/1748-5908-6-22Cite this article as: Coutu et al.: Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A study protocol. ... 6:22http://www.implementationscience.com/content/6/1/22Page 4 of 8STUD Y PRO T O C O L Open Access Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A ... processof decision making of patient and clinician, in whichinformation is exchanged, preferences are expressed and discussed, and agreement is reached regarding the goals and action plan to pursue....
- 8
- 194
- 0
báo cáo khoa học: " Translating shared decision-making into health care clinical practices: Proof of concepts" pot
... research initiative are many:International and interdisciplinary group of researchersdedicated to implementing SDM in clinical practice using a dyadic perspective; conceptual and analyticalapproaches ... context that there is con-siderable interest today in the process of shared decision- making (SDM) [2]. SDM is defined as a decision- making process jointly shared by patients and their health careprovider ... today in shared decision- making (SDM), defined as a decision- making process jointly shared by patients and their health care provider. However, the data show that SDM has not been broadlyadopted...
- 6
- 203
- 0
báo cáo khoa học: " Translating shared decision-making into health care clinical practices: Proof of concepts" pptx
... research initiative are many:International and interdisciplinary group of researchersdedicated to implementing SDM in clinical practice using a dyadic perspective; conceptual and analyticalapproaches ... analyze dyadic data and explore the impact ofsuch analysis on the theoretical underpinnings guidingthe implementation of SDM in clinical practice; and 3) todefine a research agenda and best practices ... today in shared decision- making (SDM), defined as a decision- making process jointly shared by patients and their health care provider. However, the data show that SDM has not been broadlyadopted...
- 6
- 217
- 0
Báo cáo khoa học: The lactate dehydrogenases encoded by the ldh and ldhB genes in Lactococcus lactis exhibit distinct regulation and catalytic properties ) comparative modeling to probe the molecular basis pdf
... sufficient to sustain the lactate flux.Therefore, there must be an additional factor actingas an inhibitor of LDHB, and the best candidate isintracellular lactate. At an external pH of 5.5 (orlower), ... (Protein Data Bank code 1LDN)[38], containing NADH, oxamate and Fru(1,6)P2, solvedat 2.5 A ˚resolution, and of Lactobacillus pentosus (LDH-Lp) (Protein Data Bank code 1EZ4), containing NADH[39]. ... hundred and fifty nanograms of totalproteinÆmL)1was used to assay LDHB and 300 ng of totalproteinÆmL)1to assay LDH.PK and PFK activities were assayed in cell extracts asdescribed by Garrigues...
- 13
- 464
- 0
Báo cáo khoa học: A large complex mediated by Moc1, Moc2 and Cpc2 regulates sexual differentiation in fission yeast ppt
... GGGGATCCGTCGACCTGCAGCGTACGAAAGTACTGGTCGATTTAAGACMoc3-Y GTTTAAACGAGCTCGAATTCATCGATGCTAGACAAAATCACGCMoc3-Z GCCGTGGTCGGTTCCGMoc4 tagging primersMoc4-W CCTAAGCTGTGCGTTCAATCMoc4-X GGGGATCCGTCGACCTGCAGCGTACGAAGGAGATTGCTTAATAGTTGCACMoc4-Y ... GGGGATCCGTCGACCTGCAGCGTACGA CCACCAGGATTGAGCACMoc2-Y GTTTAAACGAGCTCGAATTCATCGATGGGTTACGTGCATCTGTGMoc2-Z CATGAGCTCAAAGCCTGMoc3 tagging primersMoc3-W CTCGAAGTCATGCTCCMoc3-X GGGGATCCGTCGACCTGCAGCGTACGAAAGTACTGGTCGATTTAAGACMoc3-Y ... TATGTCGACTCACCGACGTTGTGTATCTACmoc2–R–SalI TTTAGTCGACTTACCACCAGGATTGAGCACmoc3–R–SalI CCAGTCGACTGACTGTCGTACCGTAATTCGmoc4–R–SalI GATGTCGACTCAAGGAGATTGCTTAATAGpGBKT7/pREP1 (Rpl32-2)rpl32-2–F–EcoRI CACAGAATTCATGGCTGCTGCTGTCAATATCrpl32-2–R–Sal1...
- 18
- 383
- 0
Báo cáo khoa học: "Unsupervised Topic Identification by Integrating Linguistic and Visual Information Based on Hidden Markov Models" potx
... International Confer-ence on Multimedia(ACM-MM05), pages 6–11.Ryohei Sasano, Daisuke Kawahara, and Sadao Kuro-hashi. 2004. Automatic construction of nominalcase frames and its application to indirect ... study considers a clause as an unit of analysis and thefollowing eight topics as a set of states: prepara-tion, sauteing, frying, baking, simmering, boiling,dishing up, steaming. In Barzilay’s model, although ... background image as visual information. Forexample, frying and boiling are usually performedon a gas range and preparation and dishing up areusually performed on a cutting board.Furthermore,...
- 8
- 354
- 0
Báo cáo khoa học: "Pulmonary intravascular lymphoma diagnosed by 18fluorodeoxyglucose positron emission tomography-guided transbronchial lung biopsy in a man with long-term survival: a case report" pot
... Takimoto T, Nakata S, Shiga J, Nagate Y, Nakagawa T,Take H, Katagiri S: Intravascular large B-cell lymphoma presentingpulmonary arterial hypertension as an initial manifestation. Intern Med2010, ... immunoperoxidase (B) stain of CD20.Black arrows show CD20+lymphocytic infiltration inside the alveolar capillary, a characteristic finding of intravascular lymphoma.Niida et al. Journal of Medical Case ... Szomor A, Zucca E, Cavalli F,Ponzoni M, International Extranodal Lymphoma Study Group (IELSG):Variations in clinical presentation, frequency of hemophagocytosis and clinical behavior of intravascular...
- 6
- 181
- 0
báo cáo khoa học: " Induction of stromule formation by extracellular sucrose and glucose in epidermal leaf tissue of Arabidopsis thaliana" pot
... 4:2.7. Sattarzadeh A, Krahmer J, Germain AD, Hanson MR: A Myosin XI TailDomain Homologous to the Yeast Myosin Vacuole-Binding DomainInteracts with Plastids and Stromules in Nicotiana benthamiana. ... manuscript; Naomi Marty and Michael Wozny forhelping with English wording; Martin Paulmann, Max Paulmann and ArminDanziger for their kind support in marking plastids. This work was supported by grants ... stro-mule inducing signals and if internal changes in sugarlevels are sufficient to change stromule frequency (making use, for example, of non-metabolizable glucose and sucrose analogues as well as...
- 10
- 584
- 0
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf
... (5'-GGGGACAAGTTTGTACAAAAAAGCAG-GCTGTGATGGCGGCAGGAGAG-3') contained attB1 site (in bold) and WRKY12R (5'-GGGGACCACTTTGTACAA-GAAAGCTGGGTTGAACACGACGGCGCACTC-3') con-tained attB2 site (in bold), ... protein-DNA interaction analyses, and draftedthe manuscript. JX generated the RNAi plants and per-formed cosegregating analysis, and protein-DNA interac-tion analyses. WX carried out promoter analysis. ... C, Hadingham S, Sorefan K, Cawley G,Bevan MW: Establishing glucose- and ABA-regulated tran-scription networks in Arabidopsis by microarray analysis and promoter classification using a relevance...
- 12
- 182
- 0
Tài liệu Báo cáo khoa học: Bioinformatics of the glycoside hydrolase family 57 and identification of catalytic residues in amylopullulanase from Thermococcus hydrothermalis doc
... (A) Q8TIT8_METAC AAM07401.1 378MA4052 (a- amylase) ND Methanosarcina acetivorans C 2A (A) Q8TIT9_METAC AAM07400.1 396MM0861 (a- amylase) ND Methanosarcina mazei Goe1 (A) Q8PYK0_METMA AAM30557.1 378MM0862 ... LengthALR2450 ND Anabaena sp. PCC7120 (B) Q8YUA2_ANASP BAB74149.1 529ALR1310 ND Anabaena sp. PCC7120 (B) Q8YXA5_ANASP BAB73267.1 744ALR0627 ND Anabaena sp. PCC7120 (B) Q8YZ60_ANASP BAB72585.1 907AQ_720 ... a common catalytic machinery, and employ a retainingmechanism for a- glycosidic bon d cleavage [3]. GH-13 is themain family [1] and contains almost 30 enzyme specificities,including cyclodextrin g...
- 10
- 577
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ