0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot

báo cáo khoa học:

báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot

... 1 Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu1*§, Jintao Zhuang1*, Wenwei Wang1, Liang Zhao1, Liangyun Zhao1, ... article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon. Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage ... and approved the final manuscript. 5Materials Renal carcinoma line A4 98 and a normal renal cell line HK-2 were obtained from Medical Academy of China (Beijing, PR China). Fetal calf...
  • 28
  • 266
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

... CCTGTCAACTGAGCAGCACTTTGeae A- F GTGGCGAATACTGGCGAGACT 890 bp Fagan et al [14]eae A- R CCCCATTCTTTTTCACCGTCGhly A- F ACGATGTGGTTTATTCTGGA 165 bp Fagan et al [14]hly A- R CTTCACGTGACCATACATATH7-F ... P010726-25, and O157-C-1-2), and 14 USAisolates; 4 strains of ATCC (A1 , A2 , A3 , and A4 ), 6 strains of Cornell University (C1, C2, C3, C4, C5, and C6), and 4strains of Pennsylvania State University ... C, da Silveira WD, da Silva Correa S, Nakazato G,Bando SY, Ribeiro MA, Pestana de Castro AF.Microbiological comparative study of isolates of Edwardsiella tarda in different countries from...
  • 13
  • 456
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

... The pandas in this case study did not respond to anti-bacterial or anti-fungal therapy. However, the clinical Isolation and identification of a canine coronavirus strain from giant pandas 263Fig. ... recommendations and then sequenced. The sequence was analyzed by GENETYX version 9.0 computer software (Software Development, Japan) and DNAMAN version 4.0 (Lynnon BioSoft, Canada).Bacteriology failed ... extracted total RNA was reverse transcribed to cDNA using avian myeloblastosis virus reverse transcriptase (TaKaRa, Japan) and oligo (dT) primers per the manu-facturer’s recommendation. The...
  • 3
  • 308
  • 0
Báo cáo khoa học: Structure and mechanism of the ThDP-dependent benzaldehyde lyase from Pseudomonas fluorescens potx

Báo cáo khoa học: Structure and mechanism of the ThDP-dependent benzaldehyde lyase from Pseudomonas fluorescens potx

... enzymesparticipate in numerous biosynthetic pathways and catalyse a broad range of reactions mainly involvingthe cleavage and the formation of C–C-bonds. Forinstance, they catalyse nonoxidative and ... Benzaldehyde lyase (BAL) catalyzes cleavage and formation of R-benzoin. BAL is known to accept several other substituted aro-matic or aliphatic acyl-acceptors as substrates for the formation of an acyloin ... synthesis of hydroxyketones viabenzaldehyde lyase and benzoylformate decarboxylasecatalyzed C-C bond formation. In Thiamine: CatalyticMechanisms in Normal and Disease States (Jordan, F &Patel,...
  • 10
  • 454
  • 0
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

... 7, p3 A3 ¢p5 A2 ¢p5 A; 8, p3 A3 ¢p5 A3 ¢p5 A; 9, adenosine; 10, mixture of A2 ¢p5 A and A2 ¢p5 A2 ¢p5 A2 ¢p5 A; 11, mixture of A2 ¢p5 A2 ¢p5 A and A3 ¢p5 A2 ¢-p5 A( m ⁄ z 924.6); 12, A2 ¢p5 A3 ¢p5 A( m ⁄ z ... PAGE (A) and western blot analysis (B) of the affinitypurified C-terminally and N-terminally His-tagged recombinant 2- 5A synthetase from G. cydonium (lanes 1 and 2, respectively) and C-terminally ... transferases of other famil-ies; however, the catalytic domain features of 2- 5A synthetases and other polymerases (e.g. DNA poly-merase b) are conserved [19,21]. The total fold of a mammalian...
  • 13
  • 429
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Growth and development of individual Douglas-fir in stands for applications to simulation in silviculture" potx

... at any development stage of thestand, the programmed computer (that be-comes a simulation system) can store thestate of all tree crowns by means of a stand map, and ... This area increases linearly from the base of the stem annual shoot; then itstays equal to the value reached at thebase of the live crown, and increasesagain toward ... from stand charac-teristics, and in Ek (1974) a non-parametric principle was used. Diameterdistributions have also arisen from a morebasic approach, considering stand...
  • 16
  • 368
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Measurement and modelling of the photosynthetically active radiation transmitted in a canopy of maritime pine P Hassika" doc

... radiata esti-mated from transmittance of the sun’s beam. AgricFor Meteorol 55Lang ARG (1991) Application of some of Cauchy’stheorems to estimation of surface areas of ... reflectance and thetransmittance of the foliage elements (ρ and τ) as well as on the PAR reflectance of theunderstorey. Reflectance (p) and transmit-tance ... season.Results appeared to be identical....
  • 16
  • 299
  • 0
báo cáo khoa học:

báo cáo khoa học: "Diagnosis and management of an immature teratoma during ovarian stimulation: a case report" ppsx

... Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser1, Martin Koskas1, Francine Walker2, Dominique Luton1 and Chadi Yazbeck1,3* ... it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.Diagnosis and management of an immature teratoma during ovarian stimulation: a case ... signs of an atypical cyst during ovarian stimulation allowed us to adopt a careful medical attitude and to adapt the required surgical oncological treatment. Introduction Ovarian teratomas...
  • 11
  • 256
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Production and purification of immunologically active core protein p24 from HIV-1 fused to ricin toxin B subunit in E. coli" ppt

... TGT ATG GAT CCT GAG CCCATA 3') and reverse primers (5' ACC TGC CTA TCA CTCGAG AAA TAA TGG TAA CCA TAT TTG GTT 3') incorpo-rated EcoRI and XhoI sites at the 5' and 3'ends ... Yong Kang (University of Western Ontario), using a forward (5' GTC GAC CCT ATA GTG CAG AAC 3') and reverse primers (5' AAG CTT TCT AGA TTA TTA CAA AACTCT TGC TTT ATG 3'), ... optimal adjuvant and carrier to enhance antiviral responses mayaccelerate the development of a vaccine candidate against HIV. The aim of this study was toinvestigate the adjuvant-carrier properties...
  • 11
  • 292
  • 0
báo cáo khoa học:

báo cáo khoa học: "Complete clinical response of metastatic hepatocellular carcinoma to sorafenib in a patient with hemochromatosis: A case report" ppsx

... carcinoma. Preliminary studies have shown ananti-tumor activity of sorafenib in a variety of tumor typessuch as renal cell carcinoma, melanoma, thyroid cancer,ovarian cancer, sarcoma, and pancreatic ... All authorsparticipated in drafting and editing the manuscript. Allauthors read and approved the final manuscript.Authors' informationThe authors provide specialized, multidisciplinary ... speculate that a subset of patients capable of attaining a complete remis-sion will be identified as more patients with advancedmetastatic HCC undergo therapy with sorafenib. Thedurability of...
  • 3
  • 206
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ