báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx
báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx
... et al.: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic ... tggagccccgtaggaatcgcatgggtctgacagtctcccagggaPCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcggaaaactaaagaatttactgttgaaacaaatggcPCR-RFLP (HaeIII) Leptin receptor gene - Q223R aaactcaacgacactctcctttgaactgacattagaggtgacPCR-RFLP ... leptin receptor genes and their products in ALL survivors. Therefore, the aim of our study was todetermine the polymorphisms of leptin and leptin recep-tor genes and plasma levels of leptin and...
- 9
- 356
- 0
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot
... in vitro datasuggest that the proline-rich fragments of C-terminalCaskin1 are functional and may interact with SH3domain-containing proteins, such as Abi2. [We havealso found an in vivo association ... Caskin1 fragmentsAs described in the introductory paragraphs, theN-terminal half of Caskin1 contains a number of well-known domains involved in protein–protein inter-action, such as the ankyrin ... domain (PRD) in this work. Caskin1 can bind the Cask adaptor protein[1], Abl-interactor-2 (Abi2), and another nine proteinsshown in this work, and is presumably involved in the signal pathway...
- 13
- 408
- 0
Báo cáo khoa học: "Plasma haptoglobin and immunoglobulins as diagnostic indicators of deoxynivalenol intoxication" potx
... recycling. Haptoglobin is increased in patients with acute inflammatory disease as one of positive acute phase proteins (APPs) and it is involved Plasma diagnostic indicators of deoxynivalenol intoxication ... identification of potential biomarkers against a variety of diseases, including tumors and diabetes, and the protein chip platform has been Plasma diagnostic indicators of deoxynivalenol intoxication ... is a positive APP, and it is increased in the blood plasma by bacterial infectious diseases and viral diseases, and for this reason haptoglobin has been suggested to be a landmark for disease...
- 10
- 320
- 0
Báo cáo khoa học: " SemiCytokines levels, Severity of acute mucositis and the need of PEG tube installation during chemo-radiation for head and neck cancer a prospective pilot study" ppt
... such as IL-1 and TNF -a [2].The pro-inflammation cytokines IL-1 and TNF -a arepresent in high levels in blood and serum during inflam-mation, and anti-inflammation cytokines are at low levels. This ... contributionsAM participated in the design of the study and clinical evaluations. MKparticipated in the design of the study and clinical evaluations, and carriedout the writing of the manuscript. SB, RAB, ... themselves and can be anindication of the pathogenesis of the tumor [8]. In thisregard, a correlation was found between high levels of inflammation cytokines IL-6 and IL-8 in the serum of patients...
- 7
- 341
- 0
báo cáo khoa học: "Plasma protein C levels in immunocompromised septic patients are significantly lower than immunocompetent septic patients: a prospective cohort study" pdf
... Care, University of Queensland, Brisbane, Australia, 5Department of Hematology, Princess Alexandra Hospital, Brisbane, Australia and 6Department of Chemical Pathology, Princess Alexandra ... 3168, Australia, 2Intensive Care, Princess Alexandra Hospital Princess Alexandra Hospital, Brisbane, Australia, 3Intensive Care, Wesley Hospital, Brisbane, Australia, 4Department of Intensive ... package. All continuous varia-bles were analysed using basic descriptive statistics and univariate analysis was performed to obtain mean, stand-ard deviation and/ or confidence limits. The variablesbetween...
- 8
- 330
- 0
báo cáo khoa học: " High levels of nucleotide diversity and fast decline of linkage disequilibrium in rye (Secale cereale L.) genes involved in frost response" doc
... populations are provided in Additional file 3.Genetic variation within and between populationsPCoA of candidat e gene haplotypes rev ealed largegenetic variation within each population and ... rye.Additional materialAdditional file 1: Primer information and details on PCRamplification of eleven candidate genes. Additional file 2: Genetic diversities of eleven candidate genes within ... Germany.Authors’ contributionsYL carried out the candidate gene and statistical analyses and drafted themanuscript. GH participated in the molecular and statistical analyses. DAprovided advice...
- 14
- 313
- 0
Báo cáo khoa học: "Plasma Melatonin Levels in Relation to the LightDark Cycle and Parental Background in Domestic Pig" ppt
... variability in the synthesis of pinealmelatonin (Zarazaga et al. 199 8a and Zarazagaet al. 1998b). In contrast to an earlier study (An-dersson et al. 2000), there was no significant ef-fect of ... centrifuged and stored at -20°C until analysed for melatonin content.Melatonin assay Plasma melatonin was analysed by radio im-munoassay (Bhhlmann Laboratories AG, Schö-nenbuch, Switzerland). Before ... 2-8°C.After 15 min the supernatant was removed and the radioactivity of the tubes was counted in a gamma counter for 2 min. Serial dilutions of pig plasma containing high concentrations of melatonin...
- 8
- 303
- 0
Báo cáo khoa học: "Plasma concentrations of cortisol and PGF2α metabolite in Danish sows during mating, and intrauterine and conventional insemination" pps
... mating, and intrauterine and conventional inseminationMattias Norrby*1, Mads T Madsen2, Charlotte Borg Alexandersen3, Hans Kindahl4 and Andrzej Madej1Address: 1Department of Anatomy, ... CentralPage 1 of 7(page number not for citation purposes)Acta Veterinaria ScandinavicaOpen AccessResearch Plasma concentrations of cortisol and PGF2α metabolite in Danish sows during mating, ... A, Einarsson S, Kindahl H: Intraluminal pressure vari-ations in the isthmus of the porcine oviduct after intrauter-ine insemination with saline, oestrogen solution or boarseminal plasma. Acta...
- 7
- 367
- 0
Báo cáo khoa học: "Cortisol levels in cerebrospinal fluid correlate with severity and bacterial origin of meningitis" pot
... cortisol levels, both in CSF and serum, in the initial phase of bacterial menin-gitis, and to assess their correlation with inflammatorycytokines as well as routinely examined laboratory parameters.Also, ... The areaunder the curve was also evaluated.Table 1Demographic and clinical data of 47 patients with bacterial meningitisParameter Bacterial meningitis patients (n = 47)Demographic characteristicsSex ... in all tests.Statistical analysesStatistical analyses were performed using SPSS software™ by a certified biomedical statistician. Data are presented as mean(standard deviation) or as median...
- 9
- 303
- 0
Tài liệu Báo cáo khoa học: The lipid ⁄ protein interface as xenobiotic target site Kinetic analysis of tadpole narcosis ppt
... ⁄ protein interface as xenobiotic target siteKinetic analysis of tadpole narcosisJoachim Altschuh1, Sebastian Walcher2 and Heinrich Sandermann, Jr3,41 Institute of Biomathematics and Biometry, ... 1249–1254.26 Mantipragada SB, Horva´th LI, Arias HR, Schwarz-mann G, Sandhoff K, Barrantes FJ & Marsh D (2003)Lipid–protein interactions and effect of local anesthet-ics in acetylcholine receptor- rich ... resistant to volatileanesthetics. Anesth Analges 95, 578–582.38 Takasaki M, Tatara T, Suezaki Y, Shirahama K,Kamaya H, Ueda I & Totoki T (1991) Effect of inhala-tion anesthetics on swimming...
- 8
- 382
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ