Báo cáo y học: "Dextromethorphan attenuated the higher vulnerability to inflammatory thermal hyperalgesia caused by prenatal morphine exposure in rat offspring" docx
Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx
... In these authors’opinions, such studies obviously represent the next logicalstep in the unfolding story of the modulation of the oligomeric structures of HIV-1 viral enzymes by synthetic peptides ... identification of synthetic peptides and small mole-cules that specifically target the subunit–subunit interfaces of these retroviral enzymes, resulting in the inactivation of theirenzymatic functioning.Keywords: ... the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules Nicolas Sluis-Cremer1 and Gilda Tachedjian21Department of Medicine, Division of Infectious Diseases,...
- 9
- 494
- 0
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf
... Inhibition of a SVMP by its endogenous inhibitors (Eur. J. Biochem. 269) 3049 Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by ... X-ray crystallography and synthetic inhibitor analogues Kai-Fa Huang1, Shyh-Horng Chiou1,2, Tzu-Ping Ko1 and Andrew H J. Wang1,21Institute of Biological Chemistry, Academia Sinica, Taipei, ... 2002 Academia Sinica (Taipei, Taiwan) for assistance in the chemicalsynthesis of inhibitor analogues. We thank Dr Yuch-Cheng Jean of the Synchrotron Radiation Research Center (Hsinchu, Taiwan) and...
- 10
- 475
- 0
Báo cáo y học: "Report on the Molecular Approaches to Osteoarthritis Symposium, Imperial College London, UK, 18–20 April 2004" docx
... Imperial College London, UK, 18–20 April 2004Jeremy Saklatvala and Hideaki NagaseKennedy Institute of Rheumatology, Imperial College Faculty of Medicine, London, UKCorresponding author: Jeremy Saklatvala, ... http://arthritis-research.com/content/6/5/203 The Kennedy Institute of Rheumatology Symposium Molecular Approaches to Osteoarthritis was held at Imperial College London on 18–20 April 2004. Itencompassed ... appearance and symptoms, and a lackof satisfactory markers for monitoring progression orresponses to therapy. Age, obesity, malalignment andprevious trauma to the joint are all risk factors and interactadditively....
- 5
- 351
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... 4Research articleDifferential expression, function and response to inflammatory stimuli of 11 β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation ... 5Induction of 11 β-HSD1 expression is specific for inflammatory cytokinesInduction of 11 β-HSD1 expression is specific for inflammatory cytokines. (a) Bone marrow, and (b) dermal and (c) synovial ... GCGATGGTCTCAGAAACCAAACReverse primer: GAGATTACAGAGGAAGTTATCCTCTGCProbe: TGCAGTGAAGGTTGCTGAGGCTCTGAGRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CTReverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTAProbe:...
- 10
- 438
- 0
Báo cáo y học: " Characterisation of the immune response to type I collagen in scleroderma" pps
... 13-acetate)/ionomycin activated T cells. (a) We detected interferon (IFN)-γ staining but no interleukin (IL)-4 staining. Mul-tiplex cytokine assay was used to analyse the cytokine profile of three ... (CI)-responsive T-cell linesTh1 polarisation of type I collagen (CI)-responsive T-cell lines. Cytokine expression of T-cell lines was determined by intracellular (IC) staining of PMA (phorbol 12-myristate ... importance of immunity to CI is emphasised by the finding that oral administration of CI to patients with SScmodulates T-cell responses and may ameliorate the disease[15]. Similar findings have...
- 9
- 341
- 0
Báo cáo y học: "Dextromethorphan attenuated the higher vulnerability to inflammatory thermal hyperalgesia caused by prenatal morphine exposure in rat offspring" docx
... AccessDextromethorphan attenuated the higher vulnerability to inflammatory thermal hyperalgesia caused by prenatal morphine exposure in rat offspringPao-Luh Tao1, Chien-Fang Chen2and Eagle Yi-Kung Huang2*AbstractBackground: ... may have a great potential in the prevention of higher vulnerability to inflammatory thermal hyperalgesia in the offspring of morphine- addicted mothers.BackgroundGrowth retardation, delayed ... more severe inflammatory hyperalgesia in the offspring rats (p18),which could be prevented by the co-administration ofDM in the damsBefore carrageenan injection, p18 rat s of the morphine group...
- 7
- 220
- 0
Báo cáo y học: "Comparison of the systemic and pulmonary inflammatory response to endotoxin of neutropenic and non-neutropenic rats" pps
... areamplified many fold, leading to the activation of the inflammatory cascade and consequently, inflammation. The role of the neutrophil in producing or modulatingthis initial cytokine response to sepsis ... inflammatory protein (MIP)-2 isone of its functional homologs [13]. In sepsis, the devel-opment of acute lung injury may be secondary to activa-tion of the inflammatory response. Sepsis syndrome ... IL-1β production is not yet present in the systemic circulation. In endotoxemia, cytokines from the systemic circulation can increase the permeability of the endothe-lium of the alveolar capillaries...
- 8
- 346
- 0
Báo cáo y học: "Intussusception of the appendix secondary to endometriosis: a case report" docx
... history of right iliacfossa pain and loose motions. Apart from longstandingdysmenorrhoea and menorrhagia, she did not have anyother symptoms. There was no past medical history to note and ... carried out in the absence of anyother findings at laparotomy.On histology, the wall of the appendix had widespreadendometrial deposits [see Figures 2 and 3] and there wasno evidence of malignancy. ... surgeons and gynaecologists for a possi-ble right hemicolectomy, total abdominal hysterectomyand bilateral salpingo-oophorectomy. A preoperative CT scan of her abdomen and pelvis did notreveal any...
- 3
- 370
- 0
Báo cáo y học: "Penetration of the sigmoid colon to the posterior uterine wall secondary to diverticulitis: a case report" docx
... University Hospital, Yokohama, Japan3Division of Pathology, Yokohama City University Hospital, Yokohama, Japan4Division of Surgery, Yokohama City University Hospital, Yokohama, JapanEmail: TA - ... Case reportOpen AccessPenetration of the sigmoid colon to the posterior uterine wall secondary to diverticulitis: a case reportTomoyuki Akiyama1, Masahiko Inamori1*, Takeshi Shimamura1,Hiroshi ... study, neither the imagingnor the colon examinations could detect the penetration.ConclusionWe report the case of a patient with penetration of the colon to the wall of the uterus secondary to...
- 3
- 280
- 0
Báo cáo y học: " Reproducibility of the airway response to an exercise protocol standardized for intensity, duration, and inspired air conditions, in subjects with symptoms suggestive of asthma" pdf
... as: Anderson et al.: Reproducibility of the airway response to an exercise protocol standardized fo r intensity, duration, and inspired air conditions, in subjects with symptoms suggestive of asthma. ... 11:120http://respiratory-research.com/content/11/1/120Page 2 of 12 RESEARC H Open Access Reproducibility of the airway response to an exercise protocol standardized for intensity, duration, and inspired air conditions, ... subjects and the data provided an opportunity to examine reproducibility of the airway response to exercise in the type of individual most likely to be referred for exercise testing for EIB.Exercise...
- 12
- 303
- 0
Báo cáo y học: "Obesity affects the chondrocyte responsiveness to leptin in patients with osteoarthritis" doc
... obese patients mayinterfere with the transcriptional machinery and may lead to the loss of cell sensitivity to leptin. The responsiveness to the adipokine was then restored in chondrocytes fromobese ... expression of leptin in cartilagecompared with lean patients, indicating that local hyper-leptinemia may be found in the joint. Interestingly, obe-sity is characterized by a systemic hyperleptinemiawhereas ... investigated by real-time PCR to evaluate chondrocyte responsiveness to leptin. Furthermore, the effect of body mass index (BMI) on leptin signalling pathways was analyzed with an enzyme-linked immunosorbent...
- 9
- 353
- 0
Báo cáo y học: " Comparison of the effects of salmeterol/fluticasone propionate with fluticasone propionate on airway physiology in adults with mild persistent asthma" docx
... 1 of 7(page number not for citation purposes)Respiratory ResearchOpen AccessResearch Comparison of the effects of salmeterol /fluticasone propionate with fluticasone propionate on airway physiology ... Corresponding author ^ Deceased AbstractBackground: This study compared the effect of inhaled fluticasone propionate (FP) with the combination of salmeterol /fluticasone propionate (SFC) on lung ... [3-6].Combination therapies of inhaled corticosteroids (ICS) with a long acting beta agonist (LABA) are effective in the treatment of asthma. The combination of salmeterol and fluticasone propionate (SFC,...
- 7
- 414
- 0
Báo cáo y học: "Shockingly complex: the difficult road to introducing new ideas to critical care" doc
... scientist, there remain elusiveissues about the underlying pathophyiology of thesediseases, especially sepsis. An understanding of the CommentaryShockingly complex: the difficult road to introducing ... technologies with the potential to improve the clinician’s ability to monitor adequacyof ‘flow’ phase resuscitation. For advocates of the introduction of new diagnostic technology to the critical caresetting, ... ‘circulatory’ hypoxia [7]. What we donot know yet is whether therapy directed at any or all ofthese problems would either improve microvascular flow or,even if flow were to be improved, whether...
- 3
- 140
- 0
Báo cáo y học: "Ability of pleth variability index to detect hemodynamic changes induced by passive leg raising in spontaneously breathing volunteer" pps
... purposes)Vol 12 No 2ResearchAbility of pleth variability index to detect hemodynamic changes induced by passive leg raising in spontaneously breathing volunteersGeoffray Keller1, Emmanuel Cassar2, ... automatically and noninvasively detect changes in ventricular preload induced by PLR in spontaneously breathing volunteers.ã Changes in preload induced by PLR also induced changes in PI. However, ... unable to predict increase in CO induced by PLR.ã PVI, as does any other dynamic indicator, appears to be a significant but weak predictor of fluid responsiveness in spontaneously breathing individuals.ã...
- 7
- 186
- 0
Báo cáo y học: ": Isotonic saline – the only solution to recommend" ppsx
... Analg 2011, 112:498-500.doi:10.1186/cc10008Cite this article as: Oremus K: Isotonic saline – the only solution to recommend? Critical Care 2011, 15:404.Oremus Critical Care 2011, 15:404 http://ccforum.com/content/15/1/404Page ... of balanced solutions. Crit Care 2010, 14:325.2. Kozek-Langenecker SA: In uence of uid therapy on the haemostatic system of intensive care patients. Best Pract Res Clin Anaesthesiol 2009, ... Egger M, Vandenbroucke JP, Dekkers OM: E cacy of experimental treatments compared with standard treatments in non-inferiority trials: a meta-analysis of randomized controlled trials. Int J...
- 2
- 182
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP