Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"
... Discussion and Conclusions To address the question whether the +T294C polymorphism in PPAR is associated with the risk for coronary heart disease and/ or plasma lipid levels in women, we investigated ... state the activities of numerous interacting genes are altered which may influence the effect of PPAR on metabolism. In our data and in the study by Skogsberg et al., the effect of the C ... software. The association between the +294T/C polymorphism and serum lipids, coronary heart disease, and body mass index (BMI) was calculated using the Student’s t-test analysis with genotype as the...
- 4
- 568
- 0
Báo cáo y học: "Vitamin D receptor gene BsmI polymorphisms in Thai patients with systemic lupus erythematosus" potx
... has beendemonstrated that patients with SLE have a lower level of 25hydroxyvitamin D3 than do healthy controls [3]. In addition,high-dose 1,25-dihydroxyvitamin D3 and its analog may beuseful ... pancreas,bone, skin, gonads, and activated T and B lymphocytes, havethe nuclear receptor for 1,25-dihydroxyvitamin D3 (VDR).Thus, it is not surprising that 1,25-dihydroxyvitamin D3 has amultitude of ... controls and 101 patients with SLE. However, this is in accordance with previous findings in the Thai population[24]. Thailand is geographically situated in an area betweenChina and India. This genetic...
- 4
- 331
- 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... based on the method byCawthon et al[33]. Briefly, commercially obtained telo-mere specific primers; CGGTTTGT TTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT (forward) and GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT ... 2008,129:60-66.doi:10.1186/1423-0127-18-41Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden. Journal of Biomedical Science ... separate into anaqueous RNA phase, an organic protein layer and a DNA interphase.RNA was extracted by adding 0.5 ml isopropanol tothe aqueous phase and incubating at-20°C overnight,then centri...
- 11
- 527
- 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
... immunestatus during ART.Background CD8+ T cells play an important role in protection againstintracellular pathogens. Eliminating CD8+ T lymphocytesfrom monkeys during chronic SIV infection resulted ... changes of CD8+ T cell subsets during initial ART are complex. Our results display a completephenotypical picture of CD8+ cell subsets during initial ART and provide insights for understanding of ... sources of patients, stage of the disease and duration of treatment time. In conclusion, the changes of CD8+ T cell subsets during initial ART are complex. Almost all of the CD8 + cell subsets declined...
- 7
- 338
- 0
Báo cáo y học: "Prevalence of Dysglycemia Among Coronary Artery Bypass Surgery Patients with No Previous Diabetic History" ppsx
... McGinn et al.: Prevalence of Dysglycemia Among Coronary Artery Bypass Surgery Patients with No Previous Diabetic History. Journal of Cardiothoracic Surgery 2011 6:104.Submit your next manuscript ... very common association of dysglycemia with coronary artery disease, since whe n including thepreviously and newly diagnosed patients, a total of 80% of all patients undergoing CABG have dysglycemia. Our ... Cardiothoracic Surgery 2011, 6:104http://www.cardiothoracicsurgery.org/content/6/1/104Page 5 of 6 RESEARCH ARTICLE Open AccessPrevalence of Dysglycemia Among Coronary Artery Bypass Surgery Patients with...
- 6
- 387
- 0
Báo cáo y học: "Prevalence of accessory deep peroneal nerve in referred patients to an electrodiagnostic medicine clinic" pdf
... AccessPrevalence of accessory deep peroneal nerve in referred patients to an electrodiagnostic medicine clinicSeyed Mansoor Rayegani1*, Elham Daneshtalab2, Mohamad Hasan Bahrami1, Dariush ... relative of healthy control group, reflectingautosomal dominant transmission [6]. Studies show that,the inheritance pattern of the accessory deep peroneal nerve is an autosomal dominant trait ... 2002.2. Kayal R, Katirji B: In Atypical deep peroneal neuropathy in the setting of an accessory deep peroneal nerve. Volume 40. Muscle & Nerve; 2009:(2):313-315.3. DeLisa JA: manul of nerve...
- 5
- 320
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx
... of symptoms.Discussion Femoral shaft fracture is usually caused by a high energytrauma. In this case it is possible that trauma energywas rotational and totally absorbed by the femoral shaft due ... this article as: Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report. Journal of Medical Case Reports 2010 4:221.Submit your next manuscript ... initial stability on the periphery of thecup. After an additional small incision at the fracture site, the fracture was initially reduced anatomically.Reduction was secured with five cerclage...
- 4
- 355
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt
... usually caused by a high energytrauma. In this case it is possible that trauma energywas rotational and totally absorbed by the femoral shaft due to the lack of motion at the dysplastic hip, ... this article as: Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report. Journal of Medical Case Reports 2010 4:221.Submit your next manuscript ... CAS E REP O R T Open AccessTreatment of a femoral shaft fracture in a patient with congenital hip disease: a case reportGeorge A Tsakotos, Stefanos D Koutsostathis*, George A MacherasAbstractIntroduction:...
- 4
- 289
- 0
Báo cáo y học: "Suppression of LPS-induced inflammatory responses in macrophages infected with Leishmania" pot
... certainproinflammatory cytokine responses in a parasite-specific manner, however it augments the production of otherproinflammatory cytokines. Our findings highlight the complexity of inflammatory ... counter -inflammatory responseagainst LPS-induced proinflammatory macrophagecytokines, we also analysed the effect of Leishmaniauptake upon LPS-induction of the proinflammatorycytokines IL-1a ... followinginduction with LPSDespite recent interest in IL-17, a key cytokine involved in a variety immune responses, including the induction of other cytokines, its production from macrophages in the...
- 9
- 210
- 0
Báo cáo y học: " Expression of Toll-like Receptor 9 in nose, peripheral blood and bone marrow during symptomatic allergic rhinitis" ppsx
... during the same period.Flow cytometry analysis of TLR9 leukocyte expression wasperformed on samples obtained during symptomatic allergic rhinitis. Samples of bone marrow, peripheral blood and ... leukocytes during allergic rhinitisFigure 5 Expression of TLR9 in leukocytes during allergic rhinitis. Intracellular expression of TLR9, presented as MFIR, in differ-ent leukocytes in healthy controls ... explain-ing the worsening of allergic inflammation during airwayinfections.ConclusionThe widespread and rich expression of TLR9 in nasal epi-thelial cells and on nearly all types of leukocytes...
- 13
- 249
- 0
Báo cáo y học: " Pharmacokinetics of recombinant activated factor VII in trauma patients with severe bleeding" pdf
... Santagostino E, Morfini M, Rocino A, Baudo F, Scaraggi FA,Gringeri A: Relationship between factor VII activity and clinicalefficacy of recombinant factor VIIa given by continuous infu-sion in patients ... properly cited.AbstractIntroduction Recombinant activated factor VII (rFVIIa) has beenused as adjunctive therapy in trauma patients with severe bleeding. However, its pharmacokinetics profile ... placebo-controlled clinical trial investigat-ing rFVIIa in severely injured trauma patients with bleedingrefractory to standard treatment is currently ongoing with exactly the same dosing regimen as...
- 10
- 348
- 0
Báo cáo y học: " Discovery of adult T-cell leukemia" doc
... Drs. Kazunari Yamaguchi, Toshio Hat-tori, and Masao Matsuoka, who are now independentlyworking in Tokyo, Sendai and Kyoto, respectively.Development of virologyThis discovery of ATL ushered ... inJapan. We can mention many examples in the field of hematology. One of these is that the incidence of chroniclymphocytic leukemia is quite low, being only 2% of allhematological malignancies. ... BioMed CentralPage 1 of 3(page number not for citation purposes)RetrovirologyOpen AccessReview Discovery of adult T-cell leukemiaKiyoshi Takatsuki*Address: Department of Internal Medicine...
- 3
- 269
- 0
Báo cáo y học: " Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms" pps
... Tamiya S, Koga S, Mita S, Uch-ino M, Mitsuya H, Matsuoka M: Impaired production of naive Tlymphocytes in human T-cell leukemia virus type I- infectedindividuals: its implications in the immunodeficient ... 1 of 16(page number not for citation purposes)RetrovirologyOpen AccessResearch Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanismsYuko Taniguchi1, ... whereas gene silencing is often not associated with DNA methylation[32,33]. In such situations, methylation of H3K9 is linkedwith loss of transcriptions [34]. It is possible that silencing of viral...
- 16
- 254
- 0
Báo cáo y học: " Infections of respiratory or abdominal origin in ICU patients: what are the differences" docx
... definedas infections occurring more than 24 hours after onset of a preexisting infection, at a site other than the abdominal or respiratory system for patients in the abdominal or respiratory ... with abdominal infections than in those with respiratory infections. Secondary infections were more common in patientswith abdominal infections (70patients,43%),thaninthose with respiratory infections ... Specifically, the odds ratio of developing secondary infe ctions increasedwith increasing duration of ICU stay in the abdominal group (Figure 1).Morbidity and mortalityAlthough the incidence of severe...
- 10
- 349
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI