0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

... (5’-CATAATGACTGGGCAAACTCATCTACCACTGCTCAA-3’)L30/43 -AS (5’-TTGAGCAGTGGTAGATGAGTTTGCCCAGTCATTATG-3’)2AY -AS1 01 (5’-CCGCTCGAGTTACTGATCATCCAACCACAGAAG-3’) 2A- AS3 01 (5’-GCTCTAGACTGATCATCCAACCACAGAAG-3’)CoxB2AY-S ... (5’-TTATTAATAATACTCGCTGGCCTC-3’)2AY-11 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’)2AY-13 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’)VP1 / 2A- S (5’-CCATCGATATGATGGGTACGTTC-3’) 2A- S10 (5’-GGAATTCATGGGGAAATTTGGACAGCAG-3’) 2A- AS2 (5’-GCTCTAGACTACTGCTCCATGGCTTCATCATC-3’) 2A- AS3 ... (5’-CCGCTCGAGTTACTGCTCCATGGCTTC-3’)2AY-21S (5’-GGAATTCCATCTTGCTACTCATAA-3’)2AY-41S (5’-GGAATTCCTCGTATCATCTACCAC-3’)2AY-61S (5’-GGAATTCGGAGTGTATTATTGTAA-3’)2AY-9 0AS (5’-TTATTAATAATACTCGCTGGCCTC-3’)2AY-110AS...
  • 9
  • 244
  • 0
Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

... helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivatorToshifumi Tetsuka1, Hiroaki Uranishi1, Takaomi Sanda1, Kaori Asamitsu1, Jiang-Ping Yang2,Flossie ... of California San Diego, La Jolla, CA, USARNA helicase A (RHA), a member of DNA and RNAhelicase f amily containing ATPase activity, is involved in many steps of gene expression such as transcription ... cytoplasmic i nhibitors IjBs.There is a ccumulating evidence i ndicating that RNAhelicase A (RHA) a cts as a transcriptional coactivator.RHA was found to interact with the CREB-binding protein(CBP)...
  • 11
  • 485
  • 0
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

... actin, protein kinase N,casein-kinase-2-like serine kinase and amphiphysin,Keywordshydrogen peroxide; peroxiredoxin II;phosphatidic acid; phospholipase D1; PMACorrespondenceM. Frohman, ... physiological ratherthan an artifact of lysis. These results also support,using a visual rather than molecular biochemicalapproach, the proposal that PMA triggers increasedinteraction between PLD1 and ... Involve-ment of protein kinase C in the phosphorylation of 46kDa proteins which are phosphorylated in parallel withactivation of NADPH oxidase in intact guinea-pig poly-morphonuclear leukocytes....
  • 9
  • 401
  • 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

... 5¢-AUAAGUAAUUUCUACGACGdTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAdTdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢(siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup-358-2)]. ... 5¢-AGCTTATCCTCGTTACAATCAAGAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIIIsites of pEGFP-NLS. The oligonucleotide fragment forNES-NLS was flanked ... RNA from C2C12 cells was purified using the RNeasykit (Qiagen, Valencia, CA, USA) and cDNA was synthesizedusing SuperScript III reverse transcriptase (Invitrogen,Carlsbad, CA, USA). Quantitative...
  • 12
  • 454
  • 0
Motivation as a Contributing Factor in Second Language Acquisition

Motivation as a Contributing Factor in Second Language Acquisition

... necessary to view motivation as one of a number of variables in an intricate model of interrelated individual and situational factors which are unique to each language learner. Motivation in ... language and then output, expressed as linguistic performance when investigating language learning. In order to examine language learning in the Japanese context it is necessary to explore a number ... defined as thelearner's orientation with regard to the goal of learning a second language. Motivation isdivided into two basic types: integrative and instrumental. Integrative motivation...
  • 7
  • 674
  • 6
A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

... languages is that of setting up comparable units of analysis within the various languages being studied. Thomas, J. (1995), “Meaning in interaction: An introduction to Pragmatics, Longman.” ... English as a foreign language, the Vietnamese learners of English usually apply what they have accumulated from the various textbooks. As a result, in some cases, they might know a grammatical ... - To find out the common strategies of encouraging in Vietnamese as a speech act. - To find out the common strategies of encouraging in English as a speech act. - To compare and contrast the...
  • 13
  • 1,583
  • 8
Reiteration as a cohesive device in news in brief on iraq war in english press = phép lặp làm phương tiện liên kết trong tin vắn về chiến tranh i rắc trên báo chí tiếng anh

Reiteration as a cohesive device in news in brief on iraq war in english press = phép lặp làm phương tiện liên kết trong tin vắn về chiến tranh i rắc trên báo chí tiếng anh

... forces.One of the troops killed was a U.S. Marine in Iraq's expansive AlAnbar province a spokesman for the multinational force said; thedead soldier's nationality was not disclosed. (CNN, ... example: ‘Put that gun down,’ said one of the lawyers at the table. His name wasRafter. He was a hard man in a courtroom, maybe the hardest lawyerthat Drake & Sweeney had.(Grisham, 2001: 1)It ... Discourse Analysis came into being as a branch oflinguistics, the term discourse‘ ’ has been defined in different ways. A discourse, according to David Nunan in the introduction of his IntroducingDiscourse...
  • 62
  • 701
  • 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx

Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx

... important to be bilingual? 9Maintaining the first language in children under three 10Maintaining the first language in years prior in children age three to six years 11Learning English as a second ... English as a second language and Multicultural EducationInterpreting and translating servicesResources Available17Supporting Children Learning English as a Second Language in the Early Years ... Assessment of learning includes reviewing, gathering and analysing information about what the learner can do, what they understand and the progress they are making at any particular point in their...
  • 31
  • 1,043
  • 2
Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... DGH2OD-values(conformational stability in absence of denaturant) wasthen calculated.[3H]-cGMP binding assayTo assay the capability of PKG wild -type to bind cGMP atdifferent urea concentrations, ... subsequently assayed for radioactivity in a scintillation counter. A negative control was performedusing a protein free sample. A. Scholten et al. PKG’s hinge region acts as a stability switchFEBS ... stabilityswitch in PKG Ia. Model of PKG with anemphasis of the N-terminal hinge region(amino acids 71 80) in the nonactive andactive states. Trypsin-susceptible argininesare depicted, as...
  • 13
  • 440
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

... carcinomas in dogs have similarities of prevalence, metastasis and diseasepattern compared with the breast cancer in human [27]. In humans, p53 gene mutations have been documented in breast cancer ... study, a total of 20cases were examined, among which there were 5 malignantmixed tumors, 4 mammary gland adenocarcinomas, 1papillary adenocarcinoma, 8 benign mixed tumors and 2mammary gland adenomas. ... al. [23]concluded that p53 staining in benign breast biopsies wasassociated with an increased risk of future breast cancer.Thus, p53 protein levels of wild type or mutant protein maybe associated...
  • 7
  • 325
  • 0

Xem thêm

Từ khóa: as a man thinketh in his heart so is he quotesfactor viiactivating protease fsap circulates as an inactive zymogen in the plasma fsap also regulates fibrinolysis by activating prourokinase or cellular activation via cleavage of plateletderived growth factor bb pdgfbb as the marburg i polymorphismhas attracted increasing attention as a component of amperometriclglutamate sensors used in the food industry and clinical biochemistry the precursor of lgoxadorned as a bridemy confessions as a special artistmedicine as a specialtyNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM