báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium 2 Index selection and independent culling levels : a replicated single generation test" potx

báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx

... traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation testJ.L. CAMPOCarmen RODRIGUEZDepartamento de Genetica Cuantitativa ... Mejora Animal,Instituto Nacional de Investigaciones Agrarias, Carretera de La Coruna Km 7, 28 040 Madrid, SpainSummary Index selection (I) was compared with independent culling ... programs, even though the advantages of minimal recordmaintenance and animal handling increase its attraction. On the other hand, thearbitrary culling levels sometimes applied...

Báo cáo khoa học: Modiﬁed PCR methods for 3¢ end ampliﬁcation from serial analysis of gene expression (SAGE) tags doc

... (20 09) 26 57 26 68 ª 20 09 The Authors Journal compilation ª 20 09 FEBSmRNAmRNANBAAAAAAA-3′NBAAAAAAA-3′NBAAAAAAAModified oligo (dT)NVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTT16161616161616165′5′5′-cap ... primer:5¢-(biotin)ATTGGCGCGCCGCGAGCACTGAGTCAATACGA(T)30VN-3¢rSAGER 1: 5¢-GCGAGCACTGAGTCAATACGA-3¢rSAGEF 1: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢TSP (tag-speciﬁc primer ): See step 7.Linker A 1: 5¢-AAGCAGTGGTATCAACGCAGAGTCATG-3¢Linker ... C7-3¢.Linker B: 5¢-TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG-3¢ and 5¢-pTCCCCGTACATCGTTAGAAGCTTGAATTCGAGCAG-amino modiﬁed C7-3¢SAGE sense primer: 5¢-GGATTTGCTGGTGCAGTACA-3¢ for linker A or...

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... 6-phosphate and 40 mm glucose 6-phosphate; 30% KOHwas added to the control of each assay. Reactions wereincubated for 30 min at 25 and 4 °C, and then at 10 minat 95 °C. Anthrone 0 .2% in 95% H 2 SO4was ... Ichimura K, Imada S & Yamaki S (20 01)Sucrose synthase and sucrose phosphate synthase, butnot acid invertase, are regulated by cold acclimation and deacclimation in cabbage seedlings. J Plant ... photosynthetic activ-ity has also been demonstrated [21 ], and it was shownthat acclimation does not take place in total darkness.Strand et al. [22 ] found that cold acclimation was sig-niﬁcantly enhanced...

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

... interfaces within neuronal nAChR subunitcombinations (compare Fig. 2A C)4.Sofar ,a- conotoxinsselectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) interfaceshave ... presumably a3 b2b4* and a6 /a3 b2b4* nAChRs in canine intracardiacganglia, rat medial habenula neurons and in locus coerulusneurons [75,76,79] (Fig. 2B). Interestingly, a (H1 2A) ana-logue of MII, ... nAChRs: a major population of a- BTX binding a7 * nAChRs whichis mainly localized perisynaptically, and a less abundantpopulation of a3 * nAChRs which contain a5 andb4subunits and in some cases b2 subunits,...

Tài liệu Báo cáo khoa học: "Phrase-Based Backoff Models for Machine Translation of Highly Inﬂected Languages" docx

... usu-ally works well in cases where the domain isﬁxed, the training and test data match, and a largeamount of training data is available. Nevertheless,standard SMT models tend to perform much ... Building and Us-ing Parallel Texts: Data-Driven Machine Transla-tion and Beyond, pages 91–94, Ann Arbor, Michi-gan.D. Gildea. 20 01. Statistical Language UnderstandingUsing Frame Semantics. ... in- domain and 42 Phrase-Based Backoff Models for Machine Translation of Highly In ectedLanguagesMei YangDepartment of Electrical EngineeringUniversity of Washin g tonSeattle, WA, USAyangmei@ee.washington.eduKatrin...

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

... simple and non-recursive base NounPhrase (baseNP) is an important subtask for many natural language processing applications,such as partial parsing, information retrieval and machine translation. ... parametertraining In this work, the training and testing data werederived from the 25 sections of Penn Treebank.We divided the whole Penn Treebank data into two sections, one for training and ... Treebank II, and the definition of baseNP is the same asRamshaw’s, Table 1 summarizes the averageperformance on both baseNP tagging and POStagging, each section of the whole PennTreebank was...

Báo cáo khoa học: "Coding the Russian Alphabet for the Purpose of Mechanical Translation" pptx

... effect a much greater reduction in the total number of stems, as well as making for a more elegant and satisfactory morpho- 3 For an alternative approach, see A. G. Oettinger, Automatic Language ... “soft sign”, whereas the nominative and accusative singular of feminine nouns, the imperative singular, the second person of the present indicative and the infinitive take the “soft sign” after ... changed into *НОЖЬ. It is a matter of orthographic convention that the nominative singular of masculine nouns and the genitive plural of feminines and neuters with stems in Ш, Щ, Ж, Ц and Ч are...

Báo cáo khoa học: "Knowledge-Based Weak Supervision for Information Extraction of Overlapping Relations" ppt

... Craven and Kumlien (1999) introducedthe idea by matching the Yeast Protein Database(YPD) to the abstracts of papers in PubMed and training a naive-Bayes extractor. Bellare and Mc-Callum (20 07) ... ChristopherManning. 20 05. Incorporating non-local informa-tion into information extraction systems by gibbs sam-pling. In Proceedings of the 43rd Annual Meeting of the Association for Computational Linguistics ... sentences, (3)R, a set of relation names, and (4) ∆, a database of atomic facts of the form r(e1, e 2 ) for r ∈ R and ei∈ E. Since we are using weak learning, the Yrvariables in Y are not directly...

Báo cáo hóa học: " Research Article Accurate Methods for Signal Processing of Distorted Waveforms in Power Systems" potx

... November 20 04.[10] A. Bracale, P. Caramia, and G. Carpinelli, “Optimal evalua-tion of waveform distortion indices with Prony and rootmusic methods, ” to appear in International Journal of Power and ... analytical comparison of AEM and APM computational eﬀorts cannot be stated withgeneral validity, since AEM and APM use diﬀerent models toapproximate the waveforms. Because of this, AEM and APMcan ... DFT advanced methods can remarkably reduce theinaccuracies caused by the spectral leakage with-out remarkably increasing computational burden, and therefore could be utilized in industrial applications;(iii)...

báo cáo khoa học: "Ultrasound-guided thrombin injection for the treatment of an iatrogenic hepatic artery pseudoaneurysm: a case report" ppt

... 6(5 ):7 93-798.10. Yamakado K, Nakatsuka A, Tanaka N, Takano K, Matsumura K, Takeda K:Transcatheter arterial embolization of ruptured pseudoaneurysms withcoils and n-butyl cyanoacrylate. J Vasc Intervent Radiol ... nodosa, necrotizing vasculitis, acute pancrea-titis and hepatocellular carcinoma [2] . Most HAPs occurextrahepatically, predominantly in the right hepatic artery [2] . Intrahepatic HAPs account for ... may also sho w active bleeding and anatomicvariations such as an anomalous or replaced hepaticartery [6], and can be used in simultaneous diagnosis and treatment. The recent extended utilization...

Xem thêm