0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation" ppt

Báo cáo khoa học:

Báo cáo khoa học: "Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation" ppt

... 4:27.doi:10.1186/1748-717X-5-106Cite this article as: Mahantshetty et al.: Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation. Radiation Oncology ... volumetric modulated arcs (RapidArc, RA) and fixed field intensity modulated therapy (IMRT) for Whole Abdomen Radiotherapy (WAR) after ovarian cancer.Methods and Materials: Plans for IMRT and RA were ... Clivio A, Fogliata A, Franzetti-Pellanda A, Nicolini G, Vanetti E, Wyttenbach R,Cozzi L: Volumetric arc modulated radiotherapy for carcinomas of theanal canal. A treatment planning comparison...
  • 9
  • 396
  • 1
Báo cáo khoa học:

Báo cáo khoa học: " Whole brain radiation therapy in management of brain metastasis: results and prognostic factors" ppsx

... 9508 randomised trial. Lancet 2004,363:1665-1672.21. Aoyama H, Shirato H, Tago M, Nakagawa K, Toyoda T, Hatano K,Keniyo M, Oya N, Hirota S, Shioura H, Kunieda E, Inomata T, Hay-akawa K, Katoh ... patients with brainmetastasis treated with whole brain radiotherapy (WBRT) and estimate the potential improvement in survival for patients with brain metastases, stratified by the Radiation Therapy ... perform status, RPA class I, and treated withsurgery followed by whole brain radiotherapy had better survival.This data suggest that patients with cancer and a single metastasis to the brain may be...
  • 7
  • 358
  • 1
báo cáo hóa học:

báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot

... design, data analy-sis, and helped to draft the manuscript, APM participated in the study design and coordination and helped draft themanuscript. All authors read and approved the final man-uscript.AcknowledgementsThis ... communities, a data-base containing the names of older adults interested in clinical trials research, and advertisements placed in thelocal newspaper. We were primarily interested in targetingolder adults ... [6], inadequate dietary pro-tein intake [8], inflammation (measured by IL-6 and othercytokines) [4], and physical activity. Indeed, several rand-omized controlled trials have demonstrated that...
  • 8
  • 550
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SemiIntensity-modulated radiation therapy (IMRT) vs. 3D conformal radiotherapy (3DCRT) in locally advanced rectal cancer (LARC): dosimetric comparison and clinical implications" pptx

... Access Intensity- modulated radiation therapy (IMRT) vs.3D conformal radiotherapy (3DCRT) in locallyadvanced rectal cancer (LARC): dosimetric comparison and clinical implicationsLeire Arbea*, ... using classic anatomical landmarks (c3DCRT), 3DCRT fitting the PTV (f3DCRT), and intensity- modulated radiation therapy (IMRT) in patients with locally advanced rectal cancer (LARC).Materials ... contribution.Authors’ contributionsJA and MM: idea and concept. LA and LIR: design and development ofstudy LIR: statistical analysis. LA: writing of manuscript and study coordinator.RMM and JA: final...
  • 9
  • 501
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Orthovoltage intraoperative radiation therapy for pancreatic adenocarcinoma" pot

... Valentini V, Morganti AG, Macchia G, et al: Intraoperative radiation therapy in resected pancreatic carcinoma: long-term analysis. Int J Radiat OncolBiol Phys 2008, 70:1094-1099.17. Ruano-Ravina ... Stage II and 1 Stage III; one involving head and body,Stage III; one involving head and tail, Stage II; 2 invol-ving body alone, 1 Stage 1 and 1 Stage II; one involvingbody and tail, Stage ... article as: Bachireddy et al.: Orthovoltage intraoperative radiation therapy for pancreatic adenocarcinoma. Radiation Oncology2010 5:105.Submit your next manuscript to BioMed Central and take...
  • 6
  • 256
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Stereotactic body radiation therapy for melanoma and renal cell carcinoma: impact of single fraction equivalent dose on local control" ppt

... ofmetastatic renal cell carcinoma. Int J Radiat Oncol Biol Phys 1985,11:2007-2009.5. Halperin EC, Harisiadis L: The role of radiation therapy in themanagement of metastatic renal cell carcinoma. Cancer ... AccessStereotactic body radiation therapy for melanoma and renal cell carcinoma: impact of singlefraction equivalent dose on local controlMichelle A Stinauer1, Brian D Kavanagh1, Tracey E Schefter1, ... Gonzalez1, Thomas Flaig1, Karl Lewis1,William Robinson1, Mark Chidel2, Michael Glode1 and David Raben1*AbstractBackground: Melanoma and renal cell carcinoma (RCC) are traditionally...
  • 8
  • 278
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Effects of radiation therapy on tissue and serum concentrations of tumour associated trypsin inhibitor and their prognostic significance in rectal cancer patients" doc

... not affected byneoadjuvant radiotherapy in rectal cancer patients. Thefinding of an association between both t-TATI and s-TATI, in particular the latter, and an impaired survivalis in line ... receiving adjuvant chemotherapy comparedto patients not receiving adjuvant chemotherapy (datanot shown).Association between TATI in tissue and serum and clinicopathological characteristicsT-TATI ... clinicopathological parameters, including s-CEA and s-creatinine. Classification and regression tree (CRT)analysis was used to assess optimal cut-offs for t-TATI and s-TATI i n relation to OS. Kaplan-Meier...
  • 10
  • 404
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Whole shoot hydraulic resistance in Quercus species measured with a new high-pressure flowmeter" pps

... (Tyree et al, 1993) and for Acersaccharum and Populus deltoides (Tyree and Alexander, unpublished data). Theleaf-blade resistance includes vascular and nonvascular pathways from ... ifmost water evaporation occurs near thestomata in accordance with the evidence in support of peristomatal evaporation in substomatal cavities (Tyree and Yianoulis,1980; Yianoulis ... (Tyree and Cheung, 1977).Leaf-blade resistances are relevant to a better understanding of stomatal physio-logy because they allow us to estimategradient in water potential between...
  • 7
  • 313
  • 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

... double stranded oligos Oct-1, 5¢-TGTCGAATGCAAATCACTAGAA-3¢; Sp1, 5¢-ATTCGATCGGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAGCAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTGAGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTGGGAATTCCTAGATC-3¢; ... GAA AAG GGC GGG AGG TAC CGC ATC ACA GTC TCMu-S)77/)71 GCA AAT GCG CCA GGT ACC TTC TGG GAA CTCMu-AS)77/)71 GAG TTC CCA GAA GGT ACC TGG CGC ATT TGCMu-S)68/)59 CCG CCC TTT TGA GGT ACC AGA GAA ... 5¢-GGGCTGCTTGAGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTGGGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATTGGGCAATCTGCA-3¢ are from Santa Cruz Biotechno-logy. The binding reactions were size-fractionated on a nondenaturing, 5% acrylamide gel, run at 150 V at...
  • 13
  • 525
  • 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR TATTGGTCAAACTCGTCCAT 143MIH-SF AAGACAGGAATGGCGAGTMIH-SR AATCTCTCAGCTCTTCGGGAC ... can as yet be said. Our experiments(data not shown) indicate that MIH is episodically and, to a certain extent, stochastically released in intermoult animals, and has a short half-life of between ... totalRNA, an acceptable correlation between MIH and CHHcopy number ratios for intemoult and MT was obtained(Fig. 4), which was better than that for AK normalizeddata. Notwithstanding this, it was...
  • 9
  • 587
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM