0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "A rare coexistence of adrenal cavernous hemangioma with extramedullar hemopoietic tissue: a case report and brief review of the literature" docx

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

... subfamilyand, in this case, even to a subset of eight members. The finding that, within the A-6 subfamily, not all of its members interact with BPM1 indicates that BPM proteins assemble only with ... proteins assemble with members of the ERF⁄AP2 transcription factor family Because it has been shown previously that Arabidopsis BPM proteins use their BTB ⁄ POZ domain to interact with the cullins ... to assemble with members of the ethylene response factor ⁄ Apetala2 (ERF ⁄ AP2) tran-scription factor family. We also provide a detaileddescription of the Arabidopsis thaliana BPM family expression...
  • 12
  • 657
  • 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

... divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference Shuo Yang1, ... DNA- binding site A 60 bp single-stranded DNA RDM10, with 10 random-ized oligonucleotides in the center, i.e. CTGTCAGTGATGCATATGAACGAATN10AATCAACGACATTAGGATCCTTAGC was synthesized. A 100 ng sample of ... residues that directly contact with DNA bases and theother conserved amino acid residues that do not directly contact with DNA bases are in red and blue, respectively. Arabidopsis ERFs recognize a common...
  • 10
  • 464
  • 1
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

... 2005 FEBS 103 Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins Peter Racay*, Patrick ... Based on the twofold increase in mitochondrial volume in PV– ⁄ – fast-twitch muscles [6] we addressed the question of whether the profile of selected mitochondrial proteins corresponds to the one ... 2005)doi:10.1111/j.1742-4658.2005.05046.x Parvalbumin (PV), a small cytosolic protein belonging to the family of EF-hand calcium-binding proteins, is highly expressed in mammalian fast-twitch muscle fibers. By acting as a ‘slow-onset’...
  • 13
  • 578
  • 0
Báo cáo khoa học: Sensitivity to Hsp90-targeting drugs can arise with mutation to the Hsp90 chaperone, cochaperones and plasma membrane ATP binding cassette transporters of yeast docx

Báo cáo khoa học: Sensitivity to Hsp90-targeting drugs can arise with mutation to the Hsp90 chaperone, cochaperones and plasma membrane ATP binding cassette transporters of yeast docx

... point mutations in the native Hsp90 of yeast render cells much more sensitive to Hsp90 inhibitor drugs To test whether mutations in the native Hsp90 chaperone of yeast influence sensitivity to Hsp90 ... of Hsp90 system cochaperones and plasma membrane ATP binding cassette (ABC) transporters can sensitize cells to Hsp90 drugs Hsp90 works in association with a number of cochaperoneproteins. These ... displaces the bound GA [33].If the increased Hsp90 drug sensitivity of the T101I and A587T hsp82 mutants (Fig. 1A) was due to these mutationscausing tighter drug binding to the chaperone, thesemutations...
  • 7
  • 397
  • 2
Báo cáo khoa học: N-Methylation in polylegionaminic acid is associated with the phase-variable epitope of Legionella pneumophila serogroup 1 lipopolysaccharide pptx

Báo cáo khoa học: N-Methylation in polylegionaminic acid is associated with the phase-variable epitope of Legionella pneumophila serogroup 1 lipopolysaccharide pptx

... mAb LPS -1 bound only to LPS species lacking the mAb 2625 epitope, thus suggesting that the mAb 2625 epitope inte rferes with the binding of mAb LPS -1. The OPS of L. pneumophila Sg 1 is a polylegionaminic acid ... a-D-Manp- (1 đ 8)-Kdo disaccharide in the inner core region and the structure of the complete core region of the Legionella pneumophila serogroup 1 lipopolysaccharide. Carbohydr. Res. 304, 91 95. 11 . ... 269) Ó FEBS 2002 N-Methylation in polylegionaminic acid is associated with the phase-variable epitope of Legionella pneumophila serogroup 1 lipopolysaccharide Identiđcation of 5-(N,N-dimethylacetimidoyl)amino-...
  • 13
  • 434
  • 0
Báo cáo khoa học:Chính sách đối ngoại của Đảng với khu vực Đông Nam Á những năm đầu thế kỷ 21 pot

Báo cáo khoa học:Chính sách đối ngoại của Đảng với khu vực Đông Nam Á những năm đầu thế kỷ 21 pot

... trdm trgng nam 1997, nhieu nudc roi vdo khd khdn, khflng hodng bj cdc nudc chi phoi, sy gan ket gifla cdc nudc trong khu vyc long leo han"^ Hgi nghj khdng djnh: Khu vyc Ddng Nam A vdn ... dien Dong Nam A vd chau A - Thdi Binh Duong, nhflng tiem ndng cflng nhu nhflng thdch thuc ndy sinh trong khu vyc ndy: "O khu vyc chau A- Thdi Binh Duong ndi chung vd Ddng Nam A ndi ... thl qudc te cua Viet Nam d khu vue vd fren the gidi. " 'ã Hien nay Viet Nam va cdc nudc ASEAN ludn deu mong mudn duy tri hod binh dn djnh trong khu vuc de c6 the tap...
  • 6
  • 737
  • 1
Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx

Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx

... M. Dalziel et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Ras oncogene induces b-galactoside a2 ,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter Martin Dalziel1, ... mst172(5Â-GGATGGCACCGGCAGACATG-3Â) and mst171(5Â-CACAGAAATGGGATCAGGCC-3Â). Both humanH -Ras and K -Ras cDNA were obtained from CancerResearch UK. Human H -Ras cDNA probe was isolatedfrom an EcoRI digestion of H -Ras V12cDNA ... CMP-Neu5Ac:Galb1,(3)4GlcNAc a2 ,3-sialyltransferase; ST3Gal IV, CMP-Neu5Ac:Galb1,3GalNAc/Galb1,4GlcNAc a2 ,3-sialyltransferase; ST6Gal I, CMP-Neu5Ac:Galb1,4GlcNAc a2 ,6-sialyltransferase I; ST6Gal II,...
  • 12
  • 369
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx

... accurately as manual methods. In this paper, we investigate an automatic method that can reduce the errors of traditional automatic methods by using several evaluation results obtained manually. ... Multiple Manual Evaluation Results 3.1 Overview of Our Evaluation Method and Essential Points to be Discussed We investigate an automatic method using multiple evaluation results by a manual method ... Comparison of Yasuda’s method and other automatic methods In the same way as for the evaluation of Kazawa’s method in Exp-2, we evaluated Yasuda’s method by Precision. Two arbitrary summaries...
  • 8
  • 359
  • 0
báo cáo khoa học:

báo cáo khoa học: "Primary atypical carcinoid of the breast: A case report and brief overview of evidence" ppt

... Soga J, Osaka M, Yakuwa Y: Gut-endocrinomas (carcinoids and relatedendocrine variants) of the breast: an analysis of 310 reported cases. IntSurg 2001, 86:26-32.6. Hartgrink HH, Lagaay MB, Spaander ... Primary atypical carcinoid of the breast: A case report and brief overview of evidence. World Journal of Surgical Oncology 2011 9:52.Submit your next manuscript to BioMed Central and take full advantage ... there is no standardized treatment regarding carcinoid tumors of the breast. In most cases carcinoid tumors are approached as infiltrative carcinomas of the breast. Additionall y, the reported follow-up...
  • 4
  • 326
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Primary carcinoid tumor of the gallbladder: A case report and brief review of the literature" potx

... Tanaka T, Tsuchiya S, Miura M, Saigusa N, Yanagisawa S,Takeuchi O, Kitakata Y, Saito H, Shimizu A, Miyazaki M: A case of classical carcinoid tumor of the gallbladder: review of the Japanese publishedworks. ... arcinoid tumors of the gallbladder are rare and comprises less than 1% of all carcinoid tumors. We herein present a classical carcinoid tumor found in gallbladder of a 46-year-oldwoman and review ... forchromogranin A and NSE. This lesion was proved to be a primary carcinoid tumor of the gallbladder. A brief review of literature, clinical feature, pathology and treatment of this rare disease was...
  • 8
  • 442
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A rare coexistence of adrenal cavernous hemangioma with extramedullar hemopoietic tissue: a case report and brief review of the literature" docx

... Journal of Surgical OncologyOpen Access Case report A rare coexistence of adrenal cavernous hemangioma with extramedullar hemopoietic tissue: a case report and brief review of the literatureNikolaos ... excised and pathology revealed an adrenal hemangioma with areas of extramedullar hemopoiesis.Conclusion: Although adrenal hemangiomas are rare and their preoperative diagnosis is difficult,they ... thoracoabdominal approach.ConclusionWe presented a rare coexistence of an adrenal cavernous hemangioma with extramedullar hemopoietic tissue in a woman treated for breast cancer. Although rare, ...
  • 4
  • 234
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management" doc

... (HTML) versions will be made available soon.Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its ManagementRadiation Oncology 2011, ... 1Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management Jing Chen1, Meera Dassarath1,2, Zhongyuan Yin1, Hongli ... Surgical management of radiation -induced temporal lobe necrosis in patients with nasopharyngeal carcinoma: Report of 14 cases. Head Neck 2010. 67. Gonzalez J, Kumar AJ, Conrad CA, Levin VA: Effect...
  • 23
  • 399
  • 0
báo cáo khoa học:

báo cáo khoa học: "Hemolytic anemia due to acute cytomegalovirus infection in an immunocompetent adult: a case report and review of the literature" doc

... the hospitalization, analyzed data from the literature, and wrote the article. ST and PN analyzed data from the literature. CMD was the major contributor in writing the manuscript. AC and EG followed ... 4:334http://www.jmedicalcasereports.com/content/4/1/334Page 3 of 3 CASE REPO R T Open AccessHemolytic anemia due to acute cytomegalovirus infection in an immunocompetent adult: a case report and review of the ... can be made. In our opinion, although steroid and specific antiviraltherapy was given in our patient, the policy of “wait and see” in the presence of hemolytic anemia without severemanifestations...
  • 3
  • 394
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Complicated Crohn''''s-like colitis, associated with Hermansky-Pudlak syndrome, treated with Infliximab: a case report and brief review of the literature" pot

... ReportsOpen Access Case report Complicated Crohn's-like colitis, associated with Hermansky-Pudlak syndrome, treated with Infliximab: a case report and brief review of the literatureGeorge Kouklakis1, ... design of the study, the acquisition and interpretation of data and drafted the manuscript. MSP participated in the sequencealignment and reviewed the literature. EP participated in the sequence alignment ... improvement of her colitis, as seen on repeat colonoscopy, (Figures 3 and 4) and healing of the fistula.On a maintenance regimen of AZA 100 mg/daily and a dose of infliximab 5 mg/Kg/8 wk the patient has...
  • 7
  • 380
  • 0
báo cáo khoa học:

báo cáo khoa học:" Traumatic bone cyst of the mandible of possible iatrogenic origin: a case report and brief review of the literature" ppsx

... MedicineOpen Access Case report Traumatic bone cyst of the mandible of possible iatrogenic origin: a case report and brief review of the literatureArsinoi A Xanthinaki*1,2, Konstantinos I Choupis1,2, ... Himmelfarb R: Paresthesia and the traumatic bone cyst. Oral Surg 1976, 42:442-446.19. Curran J, Kennett S, Young A: Traumatic (haemorrhagic) bone cyst of the mandible: report of an unusual case. ... dental canal[2] and pathologic fracture of the mandible [20]. Expansion of the cortical plate of the jaw bone is often noted, usually buccally, resulting inintraoral and extraoral swelling and...
  • 5
  • 363
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ