Báo cáo y học: "Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study" docx
Báo cáo y học: "Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study" docx
... 8:45.doi:10.1186/1710-1492-6-30Cite this article as: Xu et al.: Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study. Allergy, Asthma & Clinical Immunology 2010 6:30.Submit ... allergy management from the perspective of patients or caregivers, and allergists: a qualitative studyYa S Xu1*, Sam B Waserman2, Susan Waserman3*, Lori Connors3, Kristin Stawiarski4, ... J Allergy Clin Immunol 2007,119(4):1016-8.5. Kastner M, Harada L, Waserman S: Gaps in anaphylaxis management at the level of physicians, patients, and the community: a systematicreview of the...
- 5
- 552
- 0
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
... oxygenated carpHb at 100% So2was clearly autocatalytic. The reac-tion rate initially showed a sharp increase, reached a marked peak and then displayed a decrease, as the reaction approached ... T-state stabilization by ATP and the effects of changes in O2tension ⁄ saturation during the reaction. The data revealed that the reactivity is dynamicallyinfluenced by oxygen affinity and the allosteric ... result from O2contamination [25] or the forma-tion of reaction intermediates other than metHb and HbNO [26]. In carp and rabbit there was practicallyequal formation of metHb and HbNO, and the...
- 13
- 462
- 0
Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf
... O'Hanlon TP, Jara LJ, SamayoaEA, Burgos-Vargas R, Vazquez-Mellado J, Alcocer-Varela J, Sala-zar-Paramo M, et al.: Differences in idiopathic inflammatorymyopathy phenotypes and genotypes ... Horiki T, Ichikawa Y, Moriuchi J, Hoshina Y, Yamada C, Wakaba-yashi T, Jackson K, Inoko H: HLA class II haplotypes associatedwith pulmonary interstitial lesions of polymyositis/dermato-myositis ... similar for PM and DM, at 50.4 versus 49 years,respectively. The median duration of disease at data capturewas three years for PM and DM. A similar proportion of patients in each group had ILD...
- 9
- 768
- 0
Báo cáo y học: " New technical approach for the repair of an abdominal wall defect after a transverse rectus abdominis myocutaneous flap: a case report" pot
... resorbable suture material. An additional aug-mentation was performed by the implantation of a resorbable polyglactin mesh placed on the fascial suture. The patient presented at the authors' ... disturbance, these defects canalso lead to adverse interference of the abdominal wallfunctions, as a thrust bearing for the intraabdominal pres-sure and as an antagonist of the back muscles and part of the ... signs of adhesions in the colon sigmoideum and transversum, butno other pathologies; the laboratory values were normal.Apart from an appendectomy performed 20 years ago, the patient had undergone...
- 6
- 427
- 0
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3'siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3'siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3'T7...
- 8
- 576
- 0
Báo cáo y học: "Histone tales: echoes from the past, prospects for the future" ppt
... paved the way for these changes on a site-specific scale.To test the hypothesis that dauer-induced chromatin changes can act as a ‘pacemaker’ for changes in local transcription, the authors ... their analysis to dauer, postdauer and control larvae they could further show that the altered gene expression observed in postdauer animals arises from multiple regulatory mechanisms acting ... for cellular memory formation in C. elegans.Collectively, the results from Hall and coworkers [5] suggest a two step model in the formation of a cellular memory underpinning life history...
- 3
- 350
- 0
Báo cáo y học: " Lateral rectus metastasis from an occult systemic malignancy masquerading as abducens palsy: a case report" pdf
... malignancies are com-monly breast, prostate and lungs and less commonly gas-trointestinal tract, kidney, skin (melanoma), thyroid,liver, pancreas, adrenal and salivary glands and choroidalmelanoma [1-3]. The ... extraocular muscles canpresent as isolated diplopia in the absence of a history of systemic malignancy.4. Local ophthalmic signs may be subtle or minimal inorbital and /or myogenic causes of ... MYS supervised the work. All authors read and approved the final manuscript.ConsentWritten informed consent was obtained from the patientfor publication of this case report and any accompanyingimages....
- 4
- 310
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... 40% of patients had relief for at least 12 months, and mean duration of pain relief was 14 months. Barlocher et al. 1 treated 50 patients with cryorhizotomy of the medial branch. At 1-year ... similar ef-ficacy. In a study of 76 patients treated via CT-guided cryorhizotomy of the dorsal nerve medial branch, Staender et al. 17 reported a mean VAS pain score re-duction of 3.3 at six months ... The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure. Of the 14 patients who revealed 50% or greater...
- 4
- 599
- 0
Báo cáo y học: "Godoy & Godoy technique in the treatment of lymphedema for under-privileged populations."
... and evaluate new therapeutic alternatives for the treatment of lymphedema. Godoy & Godoy’s novel approach to the treatment of lymphedema Over the last few years, Godoy & Godoy have ... of the limb. These exercises are specific and require knowledge of the venous and lymphatic anatomy and physiology. Continuous guidance and evaluation of patients are required. The authors ... recent advances and contributions. A new technique of manual lymph drainage, mechanisms of compression, development of active and passive exercising apparatuses and the adaptation of myolymphokinetic...
- 4
- 646
- 0
Báo cáo y học: " Vacuum-assisted closure in the treatment of early hip joint infection"
... contamination, usually leading to prosthesis explantation [15]. Morykwas et al. have demonstrated that the ap-plication of the V .A. C. – system increased the granu-lation tissue formation and ... and lavage of the exposed prosthesis parts. Moreover, we advance the view that an adequate wound closure can only be performed after an exact anatomical preparation and mobilisation of the ... layers. This anatomical preparation and the resulted reconstruction of the soft-tissue layers may allow an enhanced biomechanical function for the postopera-tive clinical outcome. Hereby, the...
- 6
- 575
- 1
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenhedge fund investments from the perspective of different investor typesNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ