0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

Báo cáo khoa học:

Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

... study, a total of 20cases were examined, among which there were 5 malignantmixed tumors, 4 mammary gland adenocarcinomas, 1papillary adenocarcinoma, 8 benign mixed tumors and 2 mammary gland adenomas. ... carcinomas in dogs have similarities of prevalence, metastasis and diseasepattern compared with the breast cancer in human [27]. In humans, p53 gene mutations have been documented in breast cancer ... the relationship among the clinical and histological parameters, the p53 gene mutations, itsprotein expression and MIB-1 index as a proliferativemarker in canine mammary tumors was evaluated...
  • 7
  • 325
  • 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... and ACCAGCTGGGCCAACATTTC; collagen III:TGGACAGATGCTGGTGCTGAG and GAAGGCCAGCTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGGAGCCATTGTCACACAC; and glyceraldehyde-3-phosphatedehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTACCACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCCACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAACCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTTCAA and ACCAGCTGGGCCAACATTTC; ... pro-IL-1b and that processing of pro-IL-1b into mature IL-1b requires activatingcleavage of pro-caspase 1 [23], the cleavage of bothpro-IL-1b and pro-caspase 1 was examined in hypox-ia ⁄ SD-stimulated...
  • 11
  • 653
  • 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... (UTR)obtained by RACE. The sequences of the primers were:5¢AAAATCTAGAGAAGCAAGGAACAATGAATG-3¢(5¢UTR) containing the XbaI recognition site for cloning,5¢-AAAAATGCATGAAGTTGATTGCTTGCATTAACTCAT-3¢ ... ML3p A- chain (Fig. 6). Binding of therecombinant MLp A- chains with TA7 was detected in allsamples. Interaction of the native A- chains with TA7 and MNA4 in comparison with recombinant A- chains ... recombinant ML1p and ML2p A- chains could beseen as a single band  30 kDa. The recombinant ML3p and ML3.1p A- chain preparations always gave an addi-tional band of  60 kDa (which may be seen on...
  • 11
  • 610
  • 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... plasminolysis by covalently linking a 2-antiplasmin and a 2-macroglobulin to the a chain of fibrin [131]. Cross-linking of fibrin with fibronectin and collagen at the site of injury may facilitate ... coiled-coil-containingprotein kinase 2, like the ezrin ⁄ radixin ⁄ moesin intracel-lular signalling proteins and elongation factors that arecritical for the assembly of junctional proteins and actin-cytoskeleton ... con-served in TG isoforms [2]. It consists of an N-terminalb-sandwich, a core (which contains a transamidationsite and a Ca2+-binding site, and has a helices and b sheets in equal amounts), and...
  • 17
  • 440
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Prevalence and demographics of anxiety disorders: a snapshot from a community health centre in Pakistan" ppsx

... reportedthat using cut-off score of ≥ 8 on HADS -A, GAD wasdetected with a sensitivity of 0.89 and a specificity of 0.75[19].Statistical analysisData was double entered and analyzed in Statistical ... psychosocial risk factor profile presentfor anxiety and depression in our setting. Some of thesefactors are linked to a very early marriage, hostile in- laws,financial dependency on males, and lack of ... AL, Gul A, Samad L: Preva-lence of and factors associated with anxiety and depressionamong women in a lower middle class semi-urban commu-nity of Karachi, Pakistan. J Pak Med Assoc 2002, 52(11):513-517.9....
  • 6
  • 486
  • 0
báo cáo khoa học:

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

... metastases in all invasiv e carcinomas, in thesubgroup of infiltrating duct carcinomas (IDC) and in the node negative group when cyclin E was stratified as negative and positive (low/high). In ... distant metastases Censored (+) = nodistant metastases.Table 2 Prognostic factorsp-values for allinvasivecarcinomasp-values for infiltratingduct carcinomas onlyUnivariate analysisAge ... stage of the disease in invasive lobular carcinomas but not in invasive ductalcarcinomas.Another study evaluated the bio-molecular differencesbetween ductal and lobular carcinomas in 190 in...
  • 9
  • 423
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Measurement and modelling of the photosynthetically active radiation transmitted in a canopy of maritime pine P Hassika" doc

... elements (ρ and τ) as well as on the PAR reflectance of theunderstorey. Reflectance (p) and transmit-tance (τ) in the PAR waveband on needles of maritime ... defined as the ratio between incident PAR and reflected PAR. An example of variationswith time for a day of measurements of thePAR reflectance of the canopy and theunderstorey ... with measurements, but moreOriginal articleMeasurement and modelling of the photosynthetically active radiationtransmitted in a canopy of maritime pineP HassikaP Berbigier,JM...
  • 16
  • 299
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Eag and HERG potassium channels as novel therapeutic targets in cancer" docx

... production of hypoxia inducible factor- 1(HIF-1) and thereby increasing vascular e ndothelialgrowth factor (VEGF) and increased vascularisation [35].Additionally exp ression of Eag channels has been ... acti-vated protein kinase (MAPK) signalling pathway by a mechanism tha t is independe nt of K+influx through thechannel. Eag channels also act as a scaffold for and activateCalcium -Calmodulin ... channel leading to activation of Mitogenactivated protein kinase (MARP) pathway resulting in increased cell proliferation. The Eag channels also act through the Ca calmodulin pathwayto activate...
  • 9
  • 383
  • 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... these advanceshave been accompanied by a relative decrease in thenumber of studies aimed at gaining an understanding of the structural conformation of chromatin, and thechanges in chromatin structure ... of AcH4-K16 in vivo is likely to be MOF in mammals and Drosophila, and its homologue Sas2 in yeast.MOF is H4-K16 specific and was originally identified in Drosophila as a component of the dosage ... [85]. Mast cells express GATA-2 as well as NFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ⁄ AP-1 enhanceo-some-like complex existing upstream of the two NFA-T...
  • 29
  • 743
  • 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGUGY-box family miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a 3´ ... signaling pathway, (D)Hippo signaling pathway, (E) TGF-b signalingpathway, (F) Hh signaling pathway, and (G)Wnt signaling pathway.miRNAs and cell signaling A. Ichimura et al.1612 FEBS Journal ... UTRmmu-miR-21MAPK signaling pathway A BECFDGFig. 1. Involvement of miRNAs in varioussignaling cascades. Many miRNAs are underthe control of various conserved signalingpathways and in turn regulate componentsof...
  • 9
  • 684
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM