Báo cáo toán học: "The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complements" doc
Báo cáo toán học: "The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complements" doc
... pp.15-33. The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complementsElias M. Hagosemhagos@hotmail.comSubmitted: ... vertex-deleted subgraphs of G is known as its deck. The characteristic polynomial of G is the characteristic polynomial of its adjacencymatrix A and is defined by PG(x)=det(xI − A) . We call the collection ... coefficients of x. The list of the characteristic polynomials of the vertex deleted subgraphs of the two graphs is shown in Table 1.This is hardly an indication that counter-examples exist and it may...
- 9
- 363
- 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
... real spin of the charge carriers, while for graphene it stands for the pseudo spin, i.e., the A and B sublattices of graphene. Hence, it is natural to manipulatespin transport on the surface of ... participatedin establishing the physical model and developing the numerical code. All authors haveparticipated in the interpretation of the numerical results. All authors read and approved the ... electronenergy and the barrier width. In addition, changing the length of the barrier and/ or the magnetic field can tune the total reflection and the perfect transmission regions.We also examined the electron...
- 18
- 404
- 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf
... AY3572965'-GACCATCCAAGCAGACGTGGTA CCCACAGTCT TGCTTTAACG CTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAGCTGC-3'MCP-5: GenBank Accessions # AC012294, NC_0000775'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3'5'-CAACTACAGAATCGGCGTGTGCCA-3'5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3'Journal ... 5'-AAGCAGACGTGGTAC-CCACAGTCTTGCTTTAACGCTACTTTTCCAAGATAAGGTGACTCAGAAAAG-GACAAGGGGTGAGCCCAACCACACAGCTGCT-3'3043nt) was PCR-amplified from genomic DNA isolated from FHAs using a pair of primers ... confirm accuracy. A mutant sequence (5'-AAGCAGATTTGGTACCCT-TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGTGACTCAGAAA AGGACAAGGG GTGAGCCCAACCACAAGGCTGCT-3') was generated by genomic PCRusing a...
- 15
- 541
- 0
Báo cáo toán học: " Lyapunov-type inequalities for a class of even-order differential equations" doc
... out the theoretical proof and drafted the manuscript. XH participated in the design and coordination. Both of the two authors read and approved the final manuscript.References[1] Liapunov, AM: ... tohttp://www.springeropen.comJournal of Inequalities and Applications© 2012 Zhang and He ; licensee Springer.This is an open access article distributed under the terms of the Creative Commons Attribution License ... ResearchSubmission date 19 October 2011Acceptance date 12 January 2012Publication date 12 January 2012Article URL http://www.journalofinequalitiesandapplications.com/content/2012/1/5This...
- 12
- 402
- 0
Báo cáo toán học: " Could petroleum biodegradation be a joint achievement of aerobic and anaerobic microrganisms in deep sea reservoirs?" pptx
... microorganism isolation, hydrocarbon analyses and drafted the manuscript. VMO reasearch team of graduate and post graduate students BMD, INSG and SPV carried out the DNA extraction and 16S rRNA gene ... indicating the existence of alternating aerobic and anaerobic lifecycles. A comparative biodegradation of terpanes, hopanes and steranes under aerobic and anaerobic conditions, Table 3, indicate ... for each of the aerobic (Co_Aer), anaerobic (Co_Ana) and mixed (Co_mix) microbial consortium. Samples for DNA extraction were taken at the end of the biodegradation assay and replicates of each...
- 32
- 450
- 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
... LactobacillusreuteriHema Vaidyanathan1, Vijayalakshmi Kandasamy1, Gopi Gopal Ramakrishnan1, KB Ramachandran2,Guhan Jayaraman2 and Subramanian Ramalingam1*AbstractIn this work, Lactobacillus reuteri has ... alcoholdehydrogenase.Vaidyanathan et al. AMB Express 2011, 1:37http://www.amb-express.com/content/1/1/37Page 2 of 8Materials and methodsStrains and plasmids The bacterial strains and plasmi ds used and ... than that of the native strain. Interestingly, the recombinant strain exhibited elevated rates of lactate and ethanol formation as well as reduced rate of acetate production, compared to the native...
- 8
- 399
- 0
Báo cáo toán học: "New upper bound for a class of vertex Folkman numbers" pptx
... ≥ max {a 1, ,a r}. Folkman [3] provedthat there exists a graph G such that G → (a 1, ,a r)andcl(G)=max {a 1, ,a r}.ThereforeF (a 1, ,a r; q) exists if and only if q>max {a 1, ,a r}. ... V2gives an a 2-clique in V2, which is a contradiction. Thiscompletes the proof of case 2 and of the inductive base r =2.Now we more easily handle the case r ≥ 3. It is clear thatG → (a 1, ,a r) ... non-oriented graphs without loops and multiple edges. We call a p-clique of the graph G asetofp vertices, each two of which are adjacent. The largestpositive integer p, such that the graph G contains a...
- 10
- 310
- 0
Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt
... addition, it has many other useful biomedical applications- e.g., an absorbable suture, a drug carrier, an antitumor agent, a hemostatic agent, and a wound-healing agent. Chitosan itself has been developed ... IL, Singh VP, Chaithiraphan S, Laothavorn P, Sy RG, Babilonia NA, Rahman AR, Sheikh S, Tomlinson B, Sarraf-Zadigan N. Hypertension and stroke in Asia: prevalence, control and strategies in developing ... treated with NaCl plus chitosan compared to NaCl alone. The serum electrolyte concentrations of Na+ and K+ were identical across all groups. On the other hand, the BUN levels of the NaCl...
- 6
- 406
- 1
Từ khóa: các báo cáo toán học haybáo cáo toán học haybáo cáo khoa học toán họcbáo cáo giáo dục thể chất trường tiểu họcbáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocngô bảo châu amp đỉnh cao toán họcdõi các báo cáo hoạt động thẻ và chương trình quản lý rủi ro toàn cầu của các tổ chức thẻ quốc tếbáo cáo môn học mật mã và an toàn dữ liệubáo cáo khoa học hội nghị công nghệ sinh học toàn quốc hà nội 1999nguyễn bá đức 2006 tổng quan về tình hình ung thư và công tác phòng chống ở việt nam báo cáo toàn văn hội nghị khoa học toàn quốc trang 6 26phần ii toàn văn báo cáo khoa họctheo dõi các báo cáo hoạt động thẻ và chương trình quản lý rủi ro toàn cầu của các tổ chức thẻ quốc tế2 3 hạnh kiểm của học sinh cấp thcs toàn tỉnh bình dương trích theo báo cáo năm học 2011 2012 của sở gd amp đt tỉnh bình dươngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM