Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf
Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot
... participation ofall nodes, and the limited bandwidth and battery power ofnodes.Attacks against MANETs can be classified into two cate-gories: passive attacks and active attacks. Passive attacks ... makesattack paths change frequently. Therefore, additional con-straints are placed on tracing approaches for locating theattack sources in time. Therefore, the traceback approaches8 EURASIP ... Internet and MANET whentracing a DoS attackerTo trace a remote DoS attacker in MANET is an extremelychallenging task. Two main reasons are as the following. First,an attacker can spoof a source address,...
- 9
- 657
- 0
Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx
... was amplified by tworounds of PCR using semi-nested primers. The primer setBG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) andBG2 (AATAACCTTATCCTCCTCTATAAAATAACC)were used in the first round and BG2 and ... wereprepared for high performance liquid chromatograp hy(HPLC) analysis of globin chain expression and DNAwas isolated for bisulfite sequence analysis.Baboon TreatmentsTwo baboons (P. anubis), PA ... using a liquid chromatography-tandem mass spectrometry method [16]. Values for HLLAMBDA (half life), T max (time of maximum concen-tration), Cmax (concentration at Tmax), AUCall (areaunder...
- 8
- 443
- 0
Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc
... Stankovi´c and LJ. Stankovi´c, “An architecture for the real-ization of a system for time-frequency signal analysis,” IEEETransactions on Circuits And Systems—Part II: Analog and Dig-ital ... SUBCinDataa[]Datab[]Result[]CoutParADD1LPM ADD SUBCinDataa[]Datab[]Result[]CoutLPMDFFData[]q[]OutREGOutputSM[19 0] a1 [19 0]Figure 12: FPGA schematic diagram of the 8-bit SCI architecture ... units are realized by using combina-tional logic, meaning that al l calculation operations are per-formed in parallel. The schematic diagram of its FPGA im-plementation is given in Figure 12. As...
- 18
- 385
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... parasites as potentialtargets for antiparasitic drugs. The African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease ... at 58 °C and 5 min at 72 °C. For amplification, the primer pairs 5¢-GGGAATTCCATATGCTTGAGGCTTTGCGAAAGTGCCCGACCATGTTTG-3¢ (NdeI site in bold) and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ (XhoIsite...
- 11
- 566
- 0
Báo cáo hóa học: " Research Article Novel Approaches to Enhance Mobile WiMAX Security" pdf
... Standard for Local and Metropolitan Area NetworksPart 16: Air Interface for Fixed Broadband Wireless AccessSystems, Amendment 2: Physical and Medium Access ControlLayers for Combined Fixed and ... rewritten, and themain approach was also revised with coherence.References[1] “IEEE Standard for Local and Metropolitan Area NetworksPart 16: Air Interface for Fixed Broadband Wireless AccessSystems,” ... 802.16e standard. TheRSA-based certificate approach is similar to the proposedapproach but it requires much processing delay than ourECC-based certificate approach. In case of RSA approach, theprocessing...
- 11
- 290
- 0
Báo cáo hóa học: "Research Article Novel Heuristics for Cell Radius Determination in WCDMA Systems and Their Application to Strategic Planning Studies" potx
... practical operation of theUMTS system, the capacity is available for all services andonly when the system goes to a heavy loaded situation, thecapacity reservation will be activated. This also ... Universidad de Cantabria, 39005 Santander, Spain3Departamento de Investigaci´on y Desarrollo, Grupo Vodafone, 18004 Granada, SpainCorrespondence should be addressed to S. Salcedo-Sanz, sancho.salcedo@uah.esReceived ... Teor´ a de la Se´nal y Comunicaciones, Escuela Polit´ecnica Superior, Universidad de Alcal´ a, Alcal´ a de Henares, 28871 Madrid, Spain2Departamento de Ingenier´ a de Comunicaciones,...
- 14
- 353
- 0
Báo cáo khoa học: "Bootstrapping a Stochastic Transducer for Arabic-English Transliteration Extraction" pdf
... Essen-tially, the goal is to use a language for which namedentity recognition software is readily available as a reference for tagging named entities in a language for which such software is not available. ... transcription and a candidate English transliter-ation. The method requires a manual enumeration ofthe possible transliterations for each katakana sym-bol, which is unfeasible for many language ... the867Metric Arabic Romanized English1 Bootstrap alakhyryn Algerian2 Bootstrap wslm Islam3 Fuzzy M. lkl Alkella4 Fuzzy M. ’mAn common5 ALINE skr sugar6 Leven. asab Arab7 All mark Marks8 All rwsywn...
- 8
- 389
- 0
Báo cáo hóa học: " New materials and devices for preventing catheter-related infections" pdf
... days and who are admitted to a unit that has high infection rates despite adherence toother strategies, such as maximal barrier precautions andimplementation of an educational program. As acceptableincidence ... 1:34http://www.annalsofintensivecare.com/content/1/1/34Page 5 of 928. Valles J, Fernandez I, Alcaraz D, Chacon E, Cazorla A, Canals M, Mariscal D,Fontanals D, Moron A: Prospective randomized trial of 3 antisepticsolutions for prevention of catheter ... Patrianakos AP, Kouraklis G,Poularas J, Samonis G, Tsoutsos DA, Konstadoulakis MM, Karabinis A: Real-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison...
- 9
- 826
- 0
Báo cáo hóa học: " Research Article View Synthesis for Advanced 3D Video Systems" pot
... necessary to achieve this in the past but aretoday still appropriate for a wide range of applications. For instance, 3D cinema applications based on glasses (such asIMAX theatres) are well established. ... wear glasses, but with motionparallax impression and full social interaction. MVD canserve as a generic format for 3DV in this concept as it hasclear advantages over alternative concepts based ... GENERAL FORMULATION OF DEPTH-BASEDINTERMEDIATE VIEW SYNTHESISWithin the 3DV framework, we assume a given input datain the form of color data lk, depth data dkand cameraparameters for each...
- 11
- 328
- 0
Báo cáo hóa học: " Research Article Periodic Solutions for Subquadratic Discrete Hamiltonian Systems" pot
... 1995.[4] Q. Jiang and C L. Tang, “Periodic and subharmonic solutions of a class of subquadratic second-order Hamiltonian systems,” Journal of Mathematical Analysis and Applications, vol. 328, ... 3263–3270,1998.[6] C L. Tang and X P. Wu, “Periodic solutions for a class of nonautonomous subquadratic secondorder Hamiltonian systems,” Journal of Mathematical Analysis and Applications, vol. 275, ... referee for valuable suggestions. This project is sup-ported by National Natural Science Foundation of China (no. 10471029).References[1] A. Daouas and M. Timoumi, “Subharmonics for not uniformly...
- 16
- 231
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM