Báo cáo hóa học: " Negative pressure characteristics of an evaporating meniscus at nanoscale" pptx
Báo cáo hóa học: " Negative pressure characteristics of an evaporating meniscus at nanoscale" pptx
... 6:72http://www.nanoscalereslett.com/content/6/1/72Page 3 of 7NANO EXPRESS Open Access Negative pressure characteristics of an evaporating meniscus at nanoscaleShalabh C Maroo1,2*, JN Chung1AbstractThis study aims at understanding the characteristics ... extended meniscus. Int J Heat Mass Transfer 1972, 15:1851.9. Maroo SC, Chung JN: Heat transfer characteristics and pressure variationin a nanoscale evaporating meniscus. Int J Heat Mass Transfer ... exist at extreme metastable states at the nan oscale.Water plugs at negative pressures o f 17 ± 10 bar wereachieved by fi lling water in a hydrophilic silicon oxidenano-channel of approximate...
- 7
- 292
- 0
báo cáo hóa học:" Tissue specific characteristics of cells isolated from human and rat tendons and ligaments" pptx
... concentrations produce a different pat-tern of response to that of the PT in that there is a prolif-erative response at 10-8 M but an inhibition of cell number at higher doses. At present we can ... preparation of manuscript; CGR: sourcing of human tissue, preparation of manuscript; AS: planning of experiments, some experimental work, preparation of manuscript.AcknowledgementsWe wish to thank ... citation purposes)and 100% of cells from all sources facilitating accuratecomparison of intensity data between cell types (Tables 1and 2).Interestingly in both the rat and the human patellar...
- 11
- 342
- 0
báo cáo hóa học:" Negative pressure wound therapy for soft tissue injuries around the foot and ankle" ppt
... thelateral side of the ankle in 1 case, and of the dorsum of thefoot in 12 cases. All patients had at least one tendon orbone exposed at the initiation of NPWT, and four had an associated infection ... design, patient recruitmentand follow-up, data collection and analysis, and manu-script writing. JWK carried out literature search and dataanalysis. WKM carried out data collection, patient ... wasrequired.Wound types (acute or traumatic versus chronic) andlocation were noted, and durations, numbers, and fre-Table 1: Patient and wound details before and after negative pressure wound therapyNo...
- 5
- 300
- 0
Báo cáo hóa học: " Synthesis and characteristics of NH2-functionalized polymer films to align and immobilize DNA molecules" potx
... vibration at 1,650 cm−1, and the spectra exhibit an absorption peak for decreasing the C-H stretching vibration at 2,900 cm−1 and the C-H bending vibration at 1,400 cm−1 in the case of ... plays an important role in attaching the DNA onto the substrate through a strong electrostatic interaction between the amine groups of the sample surface and the negatively charged phosphate ... synthesized (e) at 20 W power and (f) at 40 W power, respectively, and then treated with DBD at a RF power of 150 W for 60 s. Figure 4. Variation of rms roughness and contact angle for NH2-functionalized...
- 17
- 353
- 0
Báo cáo hóa học: " Research Article Characteristics of MIMO-OFDM Channels in Indoor Environments" pdf
... RESULTS AND ANALYSIS4.1. Measured MIMO-OFDM channelsFigure 3 shows an example of measured MIMO-OFDMchannels. Sets of MIMO-OFDM channels obtained at eight8 EURASIP Journal on Wireless Communications ... NLoS 2 and LoS 2 paths are shown in Figure 5.Thespread of points indicates that some pairs of MIMO subchan-nels are more correlated than others. It is apparent that themagnitude of correlation ... channel realization at 117 OFDMsubcarriers and 6400 locations is used to generate the cumu-lative distribution of MIMO channel capacity in the follow-ing analysis.Figure 10 shows the CDF of...
- 9
- 347
- 0
Báo cáo hóa học: " Development and validation of an Eating Disorders Symptom Impact Scale (EDSIS) for carers of people with eating disorders" doc
... were generated by a panel of clinicians andresearchers based on quantitative and qualitative workwith carers and reviewed by a panel of "expert carers"[12,16,26,27]. The panel was ... treat-ment, and the scales of EDSIS, ECI -negative and GHQ-12were low, and most were non significant. Significant cor-relations were found between type of diagnosis and Dys-Table 2: Factor matrix ... stages of data collection and analysis, and drafted the manu-script. JW conducted focus groups, provided clinicaladvice on design and did qualitative analysis for the items,and reviewed the manuscript....
- 9
- 528
- 0
Báo cáo hóa học: " Construction and characterization of an infectious clone of coxsackievirus A16" ppt
... the investigation of the genetic determinants of its virulence. This clone will also allow the rapid, rational development and testing of candidate live attenuated vaccines and antiviral therapeutics ... introduction/priming cDNA synthesis from negative- strand RNA P8 CCTATTGCAGACATGATTGACCAG none RT-PCR for negative- strand RNA P9 TGTTGTTATCTTGTCTCTACTAGTG none RT-PCR for negative- strand RNA Restriction enzyme ... resultant transcripts were used to transfect RD cells. At 72 h post-transfection, cells and supernatants were harvested and analyzed by microscopy and biochemical assays. Figure 2 Analysis of...
- 22
- 416
- 0
báo cáo hóa học:" Cross-cultural development of an item list for computer-adaptive testing of fatigue in oncological patients" potx
... assessment of outcomes in cancer anemiaand fatigue. Semin Hemtol 1997, 34(Suppl2):13-19.2. Vogelzang N, et al: Patient, caregiver, and oncologist perceptions of cancer-related fatigue: results of a ... Table 2.Translation issuesThe EORTC Quality of Life Department TranslationOffice translated the item list into the languages of theparticipating centres. Researchers at the participatingcentres ... physicaland mental fatigue, frequency and severity of fatigue,and the opposite of fatigue, i.e. feeling energetic), theEORTC fatigue item bank is narrower focusing only onseverity and intensity of...
- 10
- 461
- 0
Báo cáo hóa học: " On the stability of an AQCQ-functional equation in random normed spaces" potx
... Institute of Mathematics, Seoul National University.Author details1Department of Mathematics, Hanyang University, Seoul 133-791, Republic of Korea2Department of Mathematics,University of Ulsan, ... Ulsan 680-749, Republic of Korea3Department of Mathematics, Daejin University, Kyeonggi 487-711, Republic of Korea4Department of Mathematics, University of Seoul, Seoul 130-743, Republic of ... of quartic and quadratic functional equation.Park et al. Journal of Inequalities and Applications 2011, 2011:34http://www.journalofinequalitiesandapplications.com/content/2011/1/34Page 2 of...
- 12
- 395
- 0
Từ khóa: báo cáo khoa họcbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ