báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" ppt
báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" doc
... 6:14http://www.josr-online.com/content/6/1/14Page 2 of 9RESEARCH ARTICLE Open Access En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of ... Functional outcome of en bloc excision and osteoarticular allograft replacement with the Sauve-Kapandjiprocedure for Campanacci grade 3 giant- cell tumor of the distal radius.J Hand Surg Am 2006, 31(8):1340-8.30. ... 2006,88 (12) :1656-8.doi:10.1186/1749-799X-6-14Cite this article as: Saini et al .: En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of...
- 9
- 466
- 0
báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" ppt
... RESEARCH ARTICLE Open Access En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literatureRaghav Saini1, ... Functional outcome of en bloc excision and osteoarticular allograft replacement with the Sauve-Kapandjiprocedure for Campanacci grade 3 giant- cell tumor of the distal radius.J Hand Surg Am 2006, 31(8):1340-8.30. ... 2006,88 (12) :1656-8.doi:10.1186/1749-799X-6-14Cite this article as: Saini et al .: En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of...
- 9
- 703
- 0
Báo cáo hóa học: " Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness" ppt
... a link. InHTB, rate means the guaranteed bandwidth available for a given class and ce il. A number of children classes canbe created under the top-level class. Any bandwidthused between rate ... system: packet sniffing, traffic analysis, and adaptivebandwidth allocation. Packet sniffing is implemented byusing the libpcap library.The traffic analysi s and adapt ive bandwidth allocationmodules ... status of each station and the fair rate for each station. A bandwidth consumption rate for each station is calcu-lated by looking up the source/destination IP address and packet length information...
- 26
- 426
- 0
Báo cáo hóa học: " On the Krasnoselskii-type fixed point theorems for the sum of continuous and asymptotically nonexpansive mappings in Banach spaces" pptx
... the paper. All authors have contributed to, seen and approved the manuscript.Arunchai and Plubtieng Journal of Inequalities and Applications 2011, 2011:28http://www.journalofinequalitiesandapplications.com/content/2011/1/28Page ... Inequalities and Applications2011 2011:28.Arunchai and Plubtieng Journal of Inequalities and Applications 2011, 2011:28http://www.journalofinequalitiesandapplications.com/content/2011/1/28Page 11 of ... Journal of Inequalities and Applications 2011, 2011:28http://www.journalofinequalitiesandapplications.com/content/2011/1/28Page 9 of 11continuous mapping and a nonexpansive mapping on a Banach...
- 11
- 457
- 0
Báo cáo hóa học: " Indigenous fodder trees can increase grazing accessibility for landless and mobile pastoralists in northern Pakistan" ppt
... Acacia nilotica, Ficussarmentosa, Salix tetrasperma, Robinia pseudoacacia, Morus alba, Debregeasiasalicifolia, Indigofera gerardiana, Myrsine Africana, and Indigofera heterantha.3) The least ... landowning and landless social segments.The landless herders, who annually rear approximately half a million sheep and goats,are at risk because of decreasing lowland grazing areas and fodder availability ... University Kampala, Uganda.Shenk, J, and R Barnes. 1985. ’Forage analysis and its application’. In Forages: The science of Grassland Agriculture,ed. HeathM, Barnes R, Metcalfe D . Ames: Iowa State...
- 20
- 307
- 0
báo cáo hóa học:" Downscaling future climate scenarios to fine scales for hydrologic and ecological modeling and analysis" pdf
... deviations of measured climate parameters (from the National Weather Service and California Irrigation and Management InformationSystem) and PRISM para meters for 4-km cells and cells downscaled ... intomonthlymeans,anaverage55%ofthevarianceofmonthly precipitation anomalies and more than 80% of the variance of average air temperature monthly anoma-lies are captured (Hidalgo et al. 2008).Spatial ... capturing an average of 50% of daily high-resolution precipitation variance and an average of around 67% of average air temperaturevariance, across all seasons and across the contiguousUnited States....
- 15
- 329
- 0
báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc
... California, USA). The siRNA target sequenceswere as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT;CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C,AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG-Journal of Translational Medicine ... 12 (page number not for citation purposes)CACAGGTCTTTCCTTAT; CHK2 -A, ACGCCGTCCTTT-GAATAACAA; CHK2-B, AGGACTGTCTTATAAAGATTA;CHK2-C, CAGGATGGATTTGCCAATCTT; and CHK2-D,CTCCGTGGTTTGAACACGAAA. The ... gemcit-abine and with further incubation for an additional 72hours. Cell viability was assessed using a luminescence-based cell number assay and the data was analyzed asdescribed in Materials and...
- 12
- 348
- 0
Báo cáo hóa học: " Prosthetic finger phalanges with lifelike skin compliance for low-force social touching interactions" doc
... Sieber A, Carrozza MC, Dario P:Development and experimental analysis of a soft compliant tactileCabibihan et al. Journal of NeuroEngineering and Rehabilitation 2011, 8:16http://www.jneuroengrehab.com/content/8/1/16Page ... open pockets.Materials and methodsHandshake experimentsHandshake experiments were performed to investigatethe typical range of contact forces and to find out whichareas on the human hand ... intern al and exte rnal layers.Comparisons were done on the skin compliance beha-viours of the finger phalanges of the human hand, the pha-lanx of a commercially available prosthetic hand and...
- 11
- 410
- 0
báo cáo hóa học: " TLR3 signaling is either protective or pathogenic for the development of Theiler''''s virus-induced demyelinating disease depending on the time of viral infection" docx
... generated peptide-loaded tetramers. TK and CSK performed histological studies and contributed to analysis. CSK and BSK analyzed the data and wrote the manuscript. All authors have seen and approved ... immunohistochemical staining for CD3, a marker of T cells (Fig. 3Ba, d, g, and j); CD45R, a marker of B cell (Fig. 3Bb, e, h, and k); and F4/80, a marker of macrophages (Fig. 3Bc, f, i, and l). Increased ... CNS of NLM and TLR3KO-SJL at 7 and 21 dpi were analyzed by quantitative PCR. Data are expressed by fold induction after normalization to the GAPDH mRNA levels. The values given are means ± standard...
- 42
- 496
- 0
báo cáo hóa học:" Unilateral or bilateral V-Y fasciocutaneous flaps for the coverage of soft tissue defects following total knee arthroplasty" ppt
... coverage after arthroplaty alsohas the disadvantage of preventing early motion of the* Correspondence: olgasavvidou@gmail.com2Orthopaedic Department, “Thriasio” General Hospital, G. Gennimata Av.19600, ... fasciocutaneousflaps are inadequate in terms of designing and arc of rotation, the advancement of the V-Y flaps in an hori-zontal manner parallels the relaxed tension lines leaving a very satisfactory ... performed part of theliterature review and contributed in drafting of the manuscript and in theinterpretation of data. SL, AM, EV and OS performed part of the literature review and contributed...
- 5
- 488
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ