Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
Báo cáo y học: "The Geography of Chronic Obstructive Pulmonary Disease Across Time: California in 1993 and 1999"
... 19]. Gotway and Young [17] outline a combination of spatial smoothing and geostatistical upscaling or aggregation of data with point support to avoid statis-tical pitfalls associated with the ... total inflation (Table 1). This in- crease in charges could be due to a combination of factors, and may be influenced by population increase and/ or an increase in healthcare costs associated with ... ap-proach of dealing with geography as an urban/rural variable is shown to be inadequate after this study reveals that the two urban areas (San Francisco Bay Area and Los Angeles) have opposite...
- 11
- 578
- 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
... notmediate signal transduction directly but instead acts as a cofactor for the clea vage and activation of PAR4 [27].Thrombin has been shown t o cleave and a ctivate PAR1,PAR3 and PAR4, whereas ... is consistent with data in sheep showing that sMCP-1 is located to mucosal mast cells of the gastrointestinal tract, and around small bronchi and a lveolar walls in the lung [6].One of the many ... number of s ignalling pathways and intermediates suchas Ca2+mobilization, the E RK pathway, PtdIns 3-kinase and protein kinase C h ave all been identified a s mediators of proliferative signals in...
- 10
- 437
- 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... nrdF+gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientific & Educational Software, Cary, NC, USA) ... (5¢-TTT TTC TAG AGC AGG GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB 3 (5¢-AAA AGA ATT CTT AGAAGT CCC AGT CAT CGT C-3¢; additional EcoRI siteunderlined).The amplified ... operated with a collision gas of 8% H2 and 92% He. Rhodium wasused as internal standard for all measurements.For GF-AAS measurements, an AAS5 EA system (CarlZeiss GmbH, Jena, Germany) was used. Manganese...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R)10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R)Real time PCR ... & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R)2 reverse GAAGGCACGCTGAGGAAGAC A1 R5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCTCCC B13R4 both outer reverse ACGAAACCTGGCAGAGTCCAAG...
- 11
- 662
- 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... caused by ironloading has an impact in protein integrity, as indicatedby an increase in protein-bound acrolein adducts atthe cell surface, which point to acrolein-adducts as a reliable marker ... and that is translocated into the outer faceunder certain cellular states. Double-labeling with Annexin V and CD1d revealed that a large number of HepG2 cells growing in normal media alreadyexpressed ... to a decrease in the percentage of cells in the cycle4 with concomitant cell arrest in the G1 phase. Overall, and considering that in clinical situations of iron over-load fibrosis is associated...
- 14
- 682
- 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... furthercharacterize the expression of Mcm4, PCNA and Ki67 in cancer cells, a section that contains a boundary region of CIS (CIN3 of FIGO classification) and dysplasia (CIN1)was immunostained (Fig. ... proteins in a cancer-free layer of squamous epithelial cells, carcinoma in situ (CIS) and invasive cancer,all of which were observed in the same section. In thecancer-free squamous cell epithelial ... membrane was detected and quantified with an Image Analyzer (FLA2000, Fuji).Immunostaining of human tissuesParaffin-embedded surgical material from uterine cervicalcancer was cut 4-lm thick, and...
- 13
- 486
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... (scrambled c-Fos siRNA Se, 5¢-GUACGCUACCACACUUGAUTT-3¢; scrambled c-Jun siRNA1 Se,5¢-GGGAACAGAGCGGAUAGGATT-3¢; scrambled c-JunsiRNA2 Se, 5¢-GAAAGAUGGCAGAAUAGAATT-3¢; and scrambled c-Jun siRNA3 ... mercaptosuccinic acidinhibited catalase and glutathione peroxidase, whichare antioxidative enzymes that eliminate hydrogen per-oxide, and caused sustained increases in ROS levels and apoptosis in rat ... of reactiveoxygen species and apoptosis in rat primary hepatocytes. Apoptosis wasaccompanied by increased expression of BimEL, following activation of extracellular signal-regulated kinase....
- 9
- 556
- 0
Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf
... (forward) ACATCTCGCCGTACTTCATCAACTC 66Hsp60 (reverse) GGAGGAGGGCATCTTGGAACTCHsp67Ba (forward) TGGATGAACCCACACCCAATC 89Hsp67Ba (reverse) CGAGGCAACGGGCACTTCHsp68 (forward) GAAGGCACTCAAGGACGCTAAAATG ... TTGTAGCCATCGGGAACCTTGTAGHsp27 (forward) GGCCACCACAATCAAATGTCAC 171Hsp27 (reverse) CTCCTCGTGCTTCCCCTCTACCHsp40 (forward) GAGATCATCAAGCCCACCACAAC 112Hsp40 (reverse) CGGGAAACTTAATGTCGAAGGAGACHsp60 ... GAAGGCACTCAAGGACGCTAAAATG 88Hsp68 (reverse) CTGAACCTTGGGAATACGAGTGHsp70Aa (forward) TCGATGGTACTGACCAAGATGAAGG 98Hsp70Aa (reverse) GAGTCGTTGAAGTAGGCTGGAACTGHsc70-1 (forward) TGCTGGATGTCACTCCTCTGTCTC...
- 12
- 388
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); ... homologousrecombination introducing the c-myc-OR17-40 codingsequence, using primers (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢), ... hot aci-dic phenol procedure. RT-PCR was performed on DNAse-treated RNA extracts. Primers used for RT-PCR were: forthe I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and...
- 14
- 473
- 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt
... and the amount of reCBG in thesupernatant w as estim ated b y activity measurement ass aysusing 4NPGlc a s substrate. Expression of cbg-1 in P. pastoris and isolation of reCBGLarge-scale expression ... beta-glucosi-dase. Patent WO 99/03874.36. Yahata, K., Mori, K., Arai, H., Koide, S., Ogawa, Y., Mukoyama,M.,Sugawara ,A. ,Ozaki,S.,Tanaka,I.,Nabeshima,Y.&Nakao,K. (2000) Molecular c loning and e ... nucleotides encoding a p rotein of 496 a mino acids with a calculated molecular mass of 53.7 kDa. A singleputative glycosylation site was located at N47 of thededuced amino-acid sequence within the motif...
- 10
- 775
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP