báo cáo hóa học: " Change in patient concerns following total knee arthroplasty described with the International Classification of Functioning, Disability and Health: a repeated measures design" docx
Báo cáo khoa học: Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 pdf
... TCTCGAGAAAAGAGAGGCTGAAGCTGGCCCTACGGGGAGGAGTGAATTCTCATTCCTTGGGATTGGSenseAntisenseHuman ⁄ crocTTR pPIC9 1 A ACGGGCACCGGTGAATCCAAATGCCACGGAATTCTTATTCTTGTGGATCACTGSenseAntisense2 CTCGAGAAAAGAGAGGCTGAAGCTGGCCCAACGGGCACCGGACGGAATTCTTATTCTTGTGGATCACTGSenseAntisenseTruncated ... and cleavage by KEX2 occurs between arginine and glutamine in the sequence Glu-Lys-Arg-Glu-Ala-Glu-Ala. Accordingto Invitrogen, the sequence of Glu-Ala-Glu-Ala is necessaryfor correct cleavage and ... CTCGAGAAAAGAGAGGCTGAAGCTGGCCCAACGGGCACCGGACGGAATTCTTATTCTTGTGGATCACTGSenseAntisenseTruncated crocTTR pPIC9 1 CTCGAGAAAAGATCCAAATGCCCACTTATGGACGGAATTCTTATTCTTGTGGATCACTGSenseAntisenseP. Prapunpoj et al. Function of transthyretin...
- 11
- 457
- 0
Báo cáo khoa học: "Smaller Alignment Models for Better Translations: Unsupervised Word Alignment with the 0" potx
... after their invention, the IBMword-based translation models, widely avail-able in the GIZA++ toolkit, remain the dom-inant approach to word alignment and an in- tegral part of many statistical ... EMtraining as well. To test, we ran GIZA++ with the default set-ting on the smaller of our two Arabic-English datasets with the same number of iterations and found no change in F-score.3LDC catalog ... and to the anonymous reviewers fortheir valuable comments. We thank Jason Riesa forproviding the Arabic-English and Chinese-Englishhand-aligned data and the alignment visualizationtool, and...
- 9
- 304
- 0
Báo cáo khoa học: "Search in the Lost Sense of “Query”: Question Formulation in Web Search Queries and its Temporal Change" pptx
... knowledge and Wikipedia (see Du-mais et al. (2002) and the references therein). Ourfindings call for a greater synergy between QA and IR in the web search context and an improved un-derstanding of ... 2010. Mining Query Logs: TurningSearch Usage Data into Knowledge. Foundations and Trends in Information Retrieval, 4(1):1–174.Amanda Spink and H. Cenk Ozmultu. 2002. Char-acteristics of question ... show-basedgame) and “can tho nail florida” (a local business). The rest are indeed question-like: while they are notnecessarily grammatical, the desire to express the in- tent by posing it as a...
- 6
- 383
- 0
Báo cáo y học: "Advances in immunomodulating therapy of HBV infection"
... conventional interferon alfa in all efficacy parameters assessed (loss of HBeAg, normalization of serum ALT) [44]. A later study of 266 predominantly Caucasian patients, showed that peginterferon alfa-2b ... combination therapy for chronic hepatitis B infection. He has a distinguished career in research of HBV reactivation after chemotherapy. He is recognized as an international leader in clinical ... Gianotti N, Uberti-Foppa C, Boeri E, Marinelli M, Tambussi G, Finazzi R et al. Hepatitis B surface antigen clearance and appearance of antibodies against hepatitis B surface after treatment with...
- 6
- 406
- 0
Báo cáo y học: "Advances in Molecular Diagnosis of HBV Infection and Drug Resistance"
... Central Africa; B and C predominate in Asia; D is associated with southern Europe, the Middle East, and India; E is uniquely African; and F is found in Central and South America as well as in Polynesia ... sustained response to lamivudine therapy. Hepatology 2003;38:1267-1273. Tables and Figures Table 1. Advantages and disadvantages of HBV DNA testing Advantages Disadvantages Earliest indicator ... intermediate intermediate no intermediate intermediate intermediate yes MALDI-TOF <5% intermediate intermediate No intermediate intermediate intermediate yes DNA arrays na intermediate intermediate...
- 9
- 590
- 0
Tài liệu Báo cáo khoa học: Changes in purine specificity in tandem GAF chimeras from cyanobacterial cyaB1 adenylate cyclase and rat phosphodiesterase 2 pptx
... specifying cGMP over cAMP as a ligand [12].Taken together the b1–b3 region of the tandem GAFdomain appears to be a major determinant of purineselection. The tandem GAF domain of the AnabaenaAC ... FEBSto the mammalian PDE GAF domains. cAMP is the ligand for these cyanobacterial tandem GAF domains, and cAMP binding results in stimulation of the C-terminal catalytic domain [7–9].To date, ... used the tandemGAF domain of cyaB1 in which only GAF B appearsto mediate signalling to investigate ligand specification. In fact, the interacting amino acids, Arg256 and Thr258, are conserved in...
- 10
- 468
- 0
Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc
... five stranded antiparallel b-sheet (strands bC–bG)facing the interior of the phage particle, with anN-terminal hairpin (strands bAandbB) and two a- helices(aAandaB) shielding most of the upper ... across the dimer interface. Eachalso interacts with residues on the adjacent b-strand (F) and with amino acids in the alpha-helical regions as they passover the b-sheet. Thus, the M88V mutant ... formation of cavities, one in the hydrophobiccore (M88V) and the other in the protein–RNA interaction(T45S), decrease the stability of the capsid. Our findingsilluminate the role of packing in...
- 11
- 609
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... [6,8,27] or toany other sequences available in FASTA and BLASTdatabase programs at the DNA Data Bank of Jap an.Recently, we reported the cloning and s equencing of the gene encoding 4-amino-3-hydroxybenzoate ... and 2-aminomuconic acid in the modified meta-cleavage path-way (Fig. 1B). The 2-aminomuconate deaminase from s trainAP-3 and that from strain JS45 have been purified and characterized in detail [5,6]. The nucleotide ... release of ammonia, are a key enzyme in the metabolic pathways of 2-amino phenol and its deriva-tives. However, little is known about the metabolic stepsthat lead to the release of ammonia and the...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: "Experiments in Semantic Classification" pptx
... This approach, however, suffers from the disadvantage that there is always a danger of the headings being a priori; we can always ask whether any particular headings are the right ones, and there ... “Semantic Mes- sage Detection for Machine Translation, using an Interlin- gua,” Proceedings of the 1961 International Conference on Ma- chine Translation of Languages and Applied Language Analysis, ... relations with other words. We are saying that &apos ;A& apos; in some sense means the same as 'B', rather than that &apos ;A& apos; means B. We can say that this form of definition distinguishes...
- 16
- 472
- 0
Tài liệu Báo cáo khoa học: Histones in functional diversification Core histone variants pdf
... variantsRama-Haritha Pusarla and Purnima BhargavaCentre for Cellular & Molecular Biology, Tarnaka, Hyderabad, IndiaIntroductionEukaryotic cells package their DNA in the form of chromatin ... During the cell cycle, there is a spatial and temporal separation of replication and transcription.Thus variants and their modifications may regulate the timing of switching the chromatin domains ... other single strand RNA viral proteins.They show structural similarity to the DNA bindingdomain of leucine aminopeptidases, suggesting thatDNA binding activity is associated with macrodomains[30]....
- 20
- 498
- 0
Từ khóa: uncalled capital or as a reduction in payables of a special nature in accordance with the accounting classification of the contributionsbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa họcbáo cáo y họcbáo cáo môn họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)