0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Điện - Điện tử >

báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

báo cáo sinh học:

báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

... CentralPage 1 of 8(page number not for citation purposes)Human Resources for HealthOpen AccessMethodology Tracking working status of HIV/AIDS-trained service providers by means of a training ... With that funding, Jhpiego supports a Training Information Monitoring System, which stores training information forall HIV/AIDS training events supported by the same funding source. Data forms ... collected on anindividual basis at each facility. In some cases, training information was not yet entered into TIMS, and the part-ners collected all training information about the providers and their...
  • 8
  • 364
  • 0
báo cáo sinh học:

báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

... In Health Services and Systems Program Abt Associates Inc.: Bethesda, MD; 2006. 27. Tjoa A, et al.: Expanding health training institutions in Zambia: operational scale-up plans through individual ... from a 2008joint Ministry of Health and Clinton Foundation assess-ment of all 39 medical training institutions in Zambia.The assessment determined graduation rates to be 90-97%, based on available ... voluntary attrition to 0%, doubling training enrolment, and tripling training enrolment (Table 3). By itself, with no changes in attrition and hiring rates fromcurrent trends, increasing training...
  • 10
  • 427
  • 0
báo cáo sinh học:

báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

... operate and sustain the new HRIS. A Local Area Network (LAN) was installed at the UNMCand staff received training about the administration andmaintenance of the upgraded ICT system. Developing ... thedevelopment, maintenance, and continued use of theHRIS software, as well as general training on data qual-ity and project management. The goal of these one-on-one and group training initiatives was to ... Gladwin J, Dixon RA, Wilson TD: Rejection of an innovation: health information management training materials in east Africa. Health Policyand Planning 2002, 17:354-361.13. Gladwin J, Dixon RA,...
  • 10
  • 535
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system" doc

... inactive in checkpointactivation and has dominant-negative character. In contrast, the mutation Q65R, in the leucine-richdomain of Vpr that mediates DCAF1 binding, results in an inactive Vpr ... resuspended in normal growth medium.AbbreviationsVpr: viral protein R; ATR: ataxia telangiectasia-mutatedand Rad3-related protein; DCAF: DDB1-Cul 4A- associatedfactor 1; DDB1 and DDB2: damaged DNA-binding ... viral protein R induces cell cycle arrestand apoptosis through activation of the serine/threoninekinase known as the ataxia telangiectasia-mutated andRad3-related (ATR) protein [1,2]. Vpr activates...
  • 8
  • 427
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Porcine adenovirus type 3 E1Blarge protein downregulates the induction of IL-8" doc

... con-taining wild-type NF-κB (shown in boldface) motif (5'-CGTAGCCATCAGTTGCAAA TCGTGGAATTTCCTCT-3')or mutant NF-κB (mutated residues underlined) motif(5'CTAGGCCATCAGTTGCAAATCGTTTAATTTAATCT)[30] ... Lamaluddin M, Yu RK, Casola A, Ogra PL, Bra-sier AR: Transcriptional activation of the interleukin-8 gene by respiratory Syncytial virus infection in alveolar epithelialcells: Nuclear translocation ... translocation of NF-κB by interacting with NF-κB. One possible mechanism of E1Blarge action could be to act as IκB homolog and retainthe ability to bind, and inactivate NF-κB. Interestingly,PAdV-3...
  • 8
  • 375
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Prostate transglutaminase (TGase-4) antagonizes the anti-tumour action of MDA-7/IL-24 in prostate cancer" potx

... Natl Acad Sci USA 2004, 101:1554-1559.24. Gopalan B, Litvak A, Sharma S, Mhashilkar AM, Chada S, Ramesh R:Activation of the Fas-FasL signaling pathway by MDA-7/IL-24 killshuman ovarian cancer ... Grant FJ, Taylor DA, Sheppard PO, Mathewes SL, Lint W, Vanaja E,Bishop PD, O’Hara PJ: Molecular cloning and characterization of a noveltransglutaminase cDNA from a human prostate cDNA library. ... Arizona, AZ 85724-5043USAFull list of author information is available at the end of the articleAblin et al. Journal of Translational Medicine 2011, 9:49http://www.translational-medicine.com/content/9/1/49©...
  • 9
  • 374
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Resveratrol prevents inflammation-dependent hepatic melanoma metastasis by inhibiting the secretion and effects of interleukin-18" potx

... of Medicine and Dentistry, Bizkaia, Spain.3Pharmakine Ltd, Bizkaia Technology Park, Bizkaia, Spain.4CEU-San PabloSalado et al. Journal of Translational Medicine 2011, 9:59http://www.translational-medicine.com/content/9/1/59Page ... interleukin-18Clarisa Salado1, Elvira Olaso2, Natalia Gallot3, Maria Valcarcel3, Eider Egilegor3, Lorea Mendoza3andFernando Vidal-Vanaclocha4*AbstractBackground: Implantation and ... growth of metastatic cancer cells at distant organs is promoted by inflammation-dependent mechanisms. A hepatic melanoma metastasis mode l where a majority of metastases are generated viainterleukin-18-dependent...
  • 11
  • 397
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Hepatitis B virus X protein interacts with β5 subunit of heterotrimeric guanine nucleotide binding protei" pptx

... Nijhara R, Jana SS, Goswami SK, Rana A, Majumdar SS, Kumar V,Sarkar DP: Sustained activation of mitogen-activated proteinkinases and activator protein 1 by the hepatitis B virus Xprotein in ... tyrosine kinase and the G protein cou-pled receptor signaling pathways, it is likely that HBXplays a role in bridging and activating the Src-kinase andMAPK mediated pathways at the early stage of ... example, Ras andmitogen-activated protein kinase (MAPK). Both systemsappear to use specific protein-protein interactions forlocalization of key signaling intermediates to appropriatemembrane...
  • 8
  • 374
  • 0
Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

... thefollowing PCR primer sets: 5¢-GGAGATCTCCAGTGATATCGACCA-3¢ and 5¢-ACGGCTTCTACGGATCGAAACT-3¢ for PPARc ,5¢-AAGACAGCTCCTCCTCGAAGGTT-3¢ and 5¢-TGACCAAATCCCCATTTACGC-3¢ for aP2,5¢-ATCCATGGATGGACGGTAACG-3¢ ... 5¢-GCGTCGGGTAGATCCAGTT-3¢ and 5¢-CTCAGTGGGGCTTAGCTCTG-3¢ for ACC, and 5¢-AACACCCCAGCCATGTACGTAG-3¢ and 5¢-TGTCAAAGAAAGGGTGTAAAACGC-3¢ for b-actin. Expression levels of the target genes were normalized ... aP2,5¢-ATCCATGGATGGACGGTAACG-3¢ and 5¢-CTGGATCCCAATACTTCGACCA-3¢ for LPL, 5¢-TGGGTTGGCTGCTTGTG-3¢ and 5¢-GCGTGGGCAGGATGAAG-3¢for SCD, 5¢-GATGTGGAACCCATAACTGGATTCAC-3¢and 5¢-GGTCCCAGTCTCATTTAGCCACAGTA-3¢ forCD36,...
  • 10
  • 647
  • 0
báo cáo sinh học:

báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

... in Swahili. A qualitative software programme'Open code' assisted in sorting, classifying and coding thedata [34]. The data was analysed using content analysisaccording to the qualitative ... counselling includingVCT [13]. In spite of policy guidelines at the internationaland national level, infant feeding counselling remains a major challenge and a controversial issue in pMTCT in Tanzania ... qualitative analytical framework [35],which consisted of the researcher reading and re-readingthe texts, manual coding in the margins, synthesising andgrouping of data in the relatively exhaustive...
  • 11
  • 540
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam