helpful expression in a biz letter
helpful expression in a biz letter
... you …•Once again, we thank you for your … and look forward to your early reply HELPFUL EXPRESSION HELPFUL EXPRESSION IN A BUSINESS LETTER IN A BUSINESS LETTER 1. Stating the reference, ... be helpful if you can… 4. Thanking, informing4. Thanking, informing•Thank you for…•We were very pleased to inform you that…•We have much pleasure in informing about… 5. Enclosing ... Indicating willingness6. Indicating willingness•We are willing/prepared…•It would be no trouble for us…•We would certainly have no difficulty in … 7. Apologizing and expressing 7. Apologizing...
- 12
- 331
- 0
How to write a biz letter
... • Ways of starting a letter: We are writing to enquire about … I am writing in connection with … We are interested in … and we would like to know … • Ways of referring to a letter / invoice ... S. James Key phrases • Opening and closing greetings: Dear Sir or Madam / Sir / Madam →→→→ Yours faithfully Dear Mr / Mrs / Miss / Ms Smith →→→→ Yours sincerely Dear John / Mary ... sections: • an opening, where you say why you are writing, often with a reference to the past • the main message of the letter • a closing section, usually with a reference to the future At the...
- 2
- 514
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT ... cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg ... 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct...
- 9
- 497
- 0
Báo cáo " Training students’ self-expression in English through portfolio assessment: A trial in English literature " pptx
... Even a more able student in the group wrote: “… writing my ideas in a logical and readable way can be considered the main obstacle.” [Mai Anh] Class discussions and presentations also reveal ... Last Leaf by O’Henry are not only exquisite in language but also original in idea: “… Behrman’s death is not a normal death but an incarnation into his masterpiece, the picture of the last ... negative thoughts that appeared in his mind when he was left alone at the end of the chapter was not a signal of weakness but an indication of humanity. Jordan is a beloved character to readers...
- 8
- 365
- 1
Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot
... predominantFA in olive oil is oleic acid and the unsaturated ⁄ satu-rated FA ratio is 4.6. Safflower oil contains oleic acidand linoleic acid and the ratio between unsaturated FAand saturated FA ... results obtained in thepresent study indicate that adipophilin protein expression in muscle isinvolved in maintaining insulin sensitivity.AbbreviationsAdfp, adipophilin; CLB, classical lysis ... University.Statistical analysisAll data are expressed as the mean ± SEM. All statisticalanalyses were performed using prism software (GraphPadAdipophilin protein expression in muscle J. de Wilde et al.770...
- 13
- 373
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... AACEVAPD1, 3 and 6, TAA is used as anAcetabularia-specific codon usage (translated as Gln).Conversion of TAA to CAA was performed by PCR asdescribed below.AACEVAPD1 has two TAA codons in its ... cerevisiae V-ATPase was a gift from R. Hirata of the Institute of Physical and ChemicalResearch (Wako, Japan), and the antibody against the100-kDa (a) subunit of S. cerevisiae V-ATPase waspurchased ... Luria –Bertani/ampicillin mediumand the plasmid DNA was purified over a Qiagen-Tip100column.Conversion of TAA to CAA and preparation ofrecombinants in yeast expression vector In the case of AACEVAPD1,...
- 8
- 391
- 0
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf
... Interestingly, substitution ofArg61 and Arg81 impair DNA-binding in PapB, indi-cating that these residues are critical for DNA-bindingalso in FocB [25].The DNA-recognition domain of RNA polymeraserE-factor, ... (A) Subunits forming Interface-I arecolored in light and dark blue; subunits ofInterface-II are colored in light and darkcoral. (B) Interactions in Interface-I.(C) Interactions in Interface-II. ... crystallography.Acta Crystallogr D 50, 760–763.60 Panjikar S, Parthasarathy V, Lamzin VS, Weiss MS &Tucker PA (2005) Auto-Rickshaw: an automated crystalstructure determination platform as an efficient...
- 14
- 459
- 0
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt
... PCR, using primers5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAACCGTGCATTACC-3¢, and labeled with [a- 32P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway,NJ, USA). Hybridization ... PO &Matthews RG (2002) Adaptation to famine: a family ofstationary-phase genes revealed by microarray analysis.Proc Natl Acad Sci USA 99, 13471–13476.30 Glatz A, Horva´th I, Varvasovszki ... upstream of the translation initiation siteof the fbaA gene was amplified, using forward primer5¢-GCAGAAACTAGCCTAAGATG-3¢ and reverse primer5¢-CCATTTTCCGCCGCATGGTC-3¢. A 121-bp DNAfragment, prom2,...
- 12
- 395
- 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf
... (forward, 5¢-AAGGCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACAGGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco(forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢;reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin-specific ... attachedto a transilluminating base (Diagnostic Instruments, SterlingHeights, MI, USA). Photographs were taken using an Axio-Cam MRc 5 camera that was attached to the microscope.Image analysis ... fluorescencedata being collected at 0.2 °C intervals. The startingamount of the AtZFP11 transcript in each sample was cal-culated using a standard curve (logarithm of the startingquantity versus...
- 16
- 454
- 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx
... fixed and stained with an anti-(human J-chain) Ig to verify the presence of intracellularJ-chain. A further attempt to directly quantify the amountof intracellular J-chain was avoided, as retention ... 3207complexing of IgA and J-chain is a prerequisite for SCbinding. Therefore, the correlation between the IgA and SClevels in all the clones demonstrated that a sufficient amountof J-chain was available ... absorbance was read byTitertekÒ Multiskan (ICN Flow, USA). The amount ofIgA present in each supernatant was calculated relative to a standard preparation with known concentration.Verification...
- 6
- 371
- 0
Từ khóa: e spl expression in a pncbaculoviruses mediate efficient gene expression in a wide range of vertebrate cellsa pdgf ra signaling suppresses a smooth muscle actin expression in a neonatal mouse lung fibroblast cell linewriting a letter of expression of interest in a jobhow to write a formal letter of complaint in frenchhow to write a formal letter of complaint in spanishhow to write a formal letter in french samplewriting a letter of interest in a jobhow to write a business letter format in wordwriting a formal letter in apa formathow to write a formal letter in english ukwhat are the 5 parts of a friendly letter in orderlist the five parts of a friendly letter in orderhow to write a formal letter in french formatwriting a personal letter in apa formatBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật