Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt
Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt
... withintheir clauses (the main and the subordinate clause,respectively). A pairwise classifier could learn thisgiven appropriate features or, alternatively, bind-ing constraints could act as ... mean.We have adapted Balas’ algorithm to the specialneeds of coreference resolution. First and fore-most, this results in an optimization algorithm thattreats global constraints intensionally, ... order. Note that all constraintsare applied in the linear variant as well, so the onlydifference is the ordering. Linear ordering overpairs is established by sorting according to the in- dex...
- 9
- 436
- 0
Báo cáo khoa học: "Unsupervised Event Coreference Resolution with Rich Linguistic Features" potx
... Zoubin Ghahramani, and Carl Ed-ward Rasmussen. 2002. The In nite HiddenMarkov Model. In Advances in Neural InformationProcessing Systems 14 (NIPS).Cosmin Adrian Bejan and Sanda H a rabagiu. ... Coreference Resolution with Rich Linguistic FeaturesCosmin Adrian BejanInstitute for Creative TechnologiesUniversity of Southern CaliforniaMarina del Rey, CA 90292, USASanda HarabagiuHuman Language ... on.Moreover, since event coreference resolution is a complex task that involves exploring a rich set oflinguistic features, annotating a large corpus with event coreference information for a new languageor...
- 11
- 336
- 0
Báo cáo khoa học: "Optimization in Multimodal Interpretation" pdf
... conversation. It is important to have a mechanism that supports competition and ranking among these constraints to achieve an optimal interpretation, in particular, a mechanism to allow constraint ... constraints as soft, which means violable and conflicting. The interpretation that arises for an utterance within a certain context maximizes the degree of constraint satisfaction and is consequently ... ranked constraint outrank outputs that have arbitrarily many violations of lower ranked constraints. Although Optimality Theory is a grammar-based framework for natural language processing,...
- 8
- 196
- 0
Báo cáo khoa học: "Improvements in Analogical Learning: Application to Translating multi-Terms of the Medical Domain" pptx
... an example, assume L containsthe following entries: (beeta-agonistit, adren-ergic beta-agonists), (beetasalpaajat, adrenergicbeta-antagonists) and (alfa-agonistit, adrener-gic alpha-agonists). ... We might translate theFinnish term alfasalpaajat into the English termadrenergic alpha-antagonists by 1) identifyingthe input triplet: (beeta-agonistit, beetasalpaa-jat, alfa-agonistit) ; 2) ... as [adrenergic beta-agonists, adren-ergic beta-antagonists, adrenergic alpha-agonists,adrenergic alpha-antagonists].Formal analogies can be defined in terms offactorizations1. Let x be a string...
- 9
- 259
- 0
Báo cáo khóa học: Volkensin from Adenia volkensii Harms (kilyambiti plant), a type 2 ribosome-inactivating protein pptx
... in an alga [1] (Laminaria japonica), a fungus[2] (Volvariella volvacea) and bacteria [3] (Shiga and Shiga-like toxins). They are divided into three main groups. Type 1RIPs are single-chain ... proteins with N-b-glycosidase activity.Type 2 RIPs are larger proteins consisting of two distinctchains: an A- chain (with the same enzymatic activity as type1 RIPs) that is linked by a disulfide ... B-chain preferentially binds to galactosyl-terminated glycoproteins on the surface of most cells, thusallowing and facilitating A- chain entry into the cell. The A- chain damages ribosomes, and...
- 10
- 313
- 0
Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt
... structure with an asymmetric structuralmotif in a linked gA derivative. Mini-gA (11 amino-acid residues, denoted as chain A) and gA (15 resi-dues, denoted as chain B) are linked head-to-headby ... structuralmotif: asymmetric with similarity in chains A and B(chain B ¼ Val-Gly-Ala-d-Leu-chainA; Fig. 1). As a result, all the amino-acid residues are in differentchemical environments and therefore ... chains A and B areconnected head-to-head by succinic acid, in such a waythat the molecule entity starts from a C-terminus andends at another C-terminus. Such a nonstandard poly-peptide cannot...
- 12
- 446
- 0
Báo cáo khoa học: "Optimizing Story Link Detection is not Equivalent to Optimizing New Event Detection" ppt
... data. A comparison of the performance of the systemswhen part-of-speech is used against a baseline sys-Table 4: Comparison of using an “ASR stop-list”and “enhanced preprocessing” for handling ... segmentation with probabilistic latent semantic analysis. In Inter-national Conference on Information and KnowledgeManagement (CIKM), McLean, VA.Jaime Carbonell, Yiming Yang, Ralf Brown, Chun Jin,and ... false alarms and misses are re-versed for LNK and NED tasks. In the LNK task,incorrectly flagging two stories as being on the sameevent is considered a false alarm. In contrast in theNED task,...
- 8
- 244
- 0
Báo cáo khoa học: "Conundrums in Noun Phrase Coreference Resolution: Making Sense of the State-of-the-Art" docx
... (2004)).We argue that providing a resolver with the an-notated CEs is a rather unrealistic evaluation: de-termining whether an NP is part of an annotated coreference chain is precisely the job of a ... the “anaphoric” ex-tracted CEs, i.e. the extracted CEs that have anannotated twin that is not a singleton. Note thatfor the MUC datasets all extracted CEs that havetwins are considered anaphoric.Results ... thestandard test/train split. Otherwise, we randomlysplit the data into a training and test set following a 70/30 ratio.3 In trial runs, we investigated alternative classificationand clustering...
- 9
- 525
- 0
Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx
... protease gene wasisolated by PCR with the upstream primer GAACATATGGCCGATAGACAAGGAACTGTATCC and thedownstream primer AGGGGATCCCTAAAAATTTAAAGTGCAACCAATCTG. The annealing site for theupstream ... A ˚) and had van der Waals interaction with Cb of Ala28 (Ala128) at a distance of 3.9 A ˚.Thesamearrangement has been observed for other C2-symmmertricdiol-containing inhibitors [40]. As a direct ... steric hindrance by themain-chain carbonyl group of Gly48, the Cl atom had tobe positioned ÔinwardÕ against the S2 site and in closecontact with Cb of V28 and Cd of I84. The close packingagainst...
- 13
- 438
- 0
Báo cáo khoa học: "Long-Distance Dependency Resolution in Automatically Acquired Wide-Coverage PCFG-Based LFG Approximations" pptx
... continuously increas-ing efforts in the construction of parse-annotatedcorpora. Substantial treebanks2are now availablefor many languages (including English, Japanese,Chinese, German, French, ... f-structure annotations are passed to a con-straint solver to produce f-structures. Annotation is evaluated in terms of coverage and quality, sum-marised in Table 1. Coverage is near complete with 99.82% ... with the PA-PCFG in the integrated architecture against the DCU 105and 78.4% against the 2,416 automatically gener-ated f-structures for the original Penn-II treebanktrees. Evaluating against...
- 8
- 338
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ