Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... identical to the inhibitor of acrosin – the major protease of mammalianspermatozoa – from the crab-eating monkey, Macacafascicularis (Table 1).Whereas many Kazal inhibitors have proline at P2, ... PSKP-1 and PSKP-2, twovariants of a new protein isolated from the skin of the anuran, P. sauvagii, whose sequence indicates membership of the Kazal family. Most members of this family are smallprotein ... interaction with theirmembranes.Materials and methodsMaterialsAll chemicals were of the purest analytical grade available.Proteases, aprotinin, lysozyme, and a- casein were from Sigma-Aldrich....

Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

... was suggested that amineoxidases are enzymes of cellular amino acid catabo-lism, comprising potential candidates for a mechanismthat catalyses nitrogen mineralization from aminoacids at the ... T.S. wasalso partially supported by a grant from the West-Ukrainian BioMedical Research Center. The technicalassistance of Mrs Galina Shafranska during the cellculturing is highly appreciated.References1 ... intracellular molecular targets and mechanisms of action have been well characterized. In addition tothese toxic polypeptides, the death cap also containsantitoxin antamanide, a cyclodecapeptide...

Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

... in Table 2. The symbol '+' is + in the unmarked case and - in the marked case, and 'x' stands for scalar multiplication. 4 In the case of the positive and the ordinary ... compositional approach may be manageable if certain assumptions about the application domain can be made. TOPIC AREAS: semantics, AI-methods in computational linguistics 1 Introduction In the past ... in all but the trivial case of measurements, whereas the non- compositional approach guarantees at least assimi- lation completeness for a subset of the parameters in the system. This means...

Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx

... of a vitamin K-dependent carboxylaseand of Gla in phyla as disparate as Chordata and Mol-lusca suggests the existence of an ancestral carboxyla-tion system with a purpose predating blood coagulationand ... for the cone snail carboxylase [8]. It is anticipated that addi-tional structural parameters such as the a- helicity of the propeptide and the position of certain residues relativeto the a helix ... (5¢-CTCTGAGGGCGCCAAACATGTCG-3¢) andGSP2 (5¢-CGACATGTTTGGCGCCCTCAGAG-3¢)in5¢- and 3¢-RACE PCR that employed a C. textile RACElibrary as the template. Ampliﬁcation parameters were asindicated by the manufacturer. cDNAs...

Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf

... might‘Susi heard that Hans had an accident andmight die’• Categorial (phrasal and lexical) nodes —bolded in Fig. 1 — carry reference tags (pre-sumably propagated from the generator’s strate-gic ... E.g., the tag “7” is attached to the root and head nodes of both exemplars of NPHans in Fig. 1, indicating their coreferentiality.For the sake of computational uniformity, wealso attach reference ... Within a clausal con-junct, all functions are represented at the samehierarchical level. Hence, the trees are “flat,” asillustrated in Fig. 1, and similar to the trees inGerman treebanks (NEGRA-II,...

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCAReverse GCTAGGATCCCTAGCAACCACGGCACTable 2. Antifungal activity ... Odintsova1, Alexander A. Vassilevski2, Anna A. Slavokhotova1,Alexander K. Musolyamov2, Ekaterina I. Finkina2, Natalia V. Khadeeva1, Eugene A. Rogozhin2,Tatyana V. Korostyleva1, Vitalii ... sequencing. The molecularmass of the recombinant product obtained by MALDIMS was equal to the mass measured for the nativeWAMP- 1a. The ﬁnal yield of puriﬁed recombinantWAMP- 1a was  8mgÆL)1 of bacterial...

Báo cáo khoa học: A simple in vivo assay for measuring the efﬁciency of gene length-dependent processes in yeast mRNA biogenesis doc

... that measure-ment of acid phosphatase activity was the best estima-tion of the mRNA abundance in our systems, and from here on we use the ratio of acid phosphataseactivities as an indicator ... presence of sublethal amounts of MPA. (B) mRNA levels of the transcription units and strains ana-lyzed in (A) cultured in the absence of MPA. The relative values of the mRNA levels with respect to the ... cultures reached an optical density at600 nm (OD 600) of 0.8–1. Acid phosphatase activity of intact cells was assayed as described [19]. The acid phos-phatase activities of the transformants were...

Báo cáo khoa học: "a Chat-oriented Dialogue System based on the Vector Space Model" ppt

... about the characters who speak and what they said at each dialogue turn. On the other hand, context elements contain all the additional information (explanations and descriptions) appearing ... are automatically replaced by the placeholders <self-name> and <other-name>, res-pectively. In the case of a mature dialogue, when there are more terms into the vocabulary learning ... the current user input vector and all single utterances stored in the database. This score is used for retrieving a large amount of candidate utterances from the dialogue database, generally...

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

... fragment from the humantrypsinogen prepro sequence was ampliﬁed from humanpancreatic cDNA using the primer set (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), and ... 7(TACACACCCTGACCCGCATC) and 6 as template.Sequence analysis The sequence of the cDNA was analyzed using genetyxsoftware (Software Development Co. Ltd, Tokyo, Japan). A novel serine protease ... brain.Biochim Biophys Acta 1350, 11–14.11 Ogawa K, Yamada T, Tsujioka Y, Taguchi J, Takaha-shi M, Tsuboi Y, Fujino Y, Nakajima M, YamamotoT, Akatsu H, Mitsui S & Yamaguchi N (2000) Localiza-tion...

Báo cáo khoa học: "A Hierarchical Pitman-Yor Process HMM for Unsupervised Part of Speech Induction" doc

... 47th Annual Meet-ing of the Association for Computational Linguisticsand the 4th International Joint Conference on Natu-ral Language Processing of the Asian Federation of Natural Language Processing ... from the sameclass. Though PoS induction was not their aim, thisrestriction is largely validated by empirical analysis of treebanked data, and moreover conveys the sig-niﬁcant advantage that all ... DjFigure 1: Plate diagram representation of the trigramHMM. The indexes i and j range over the set of tagsand k ranges over the set of characters. Hyper-parametershave been omitted from the ﬁgure...

Xem thêm

Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM