Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... function, including steroid and lipid metabolism. In addition, gene signaling pathway analysis has identi-ﬁed gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also ... Journal 275 (2008) 1260–1273 ª 2008 The Authors Journal compilation ª 2008 FEBS 1273 A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal ... grade;TaKaRa, Kyoto, Japan).Microarray analysis and data mining (Aligentarray) A one-color microarray-based gene expression analysis sys-tem (Agilent Technologies, Tokyo, Japan) containing41...

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... anthracyclines and the more sequence-selectivebisanthracycline WP631. To gain further insight into the causes of the distinct behavior of daunorubicin and WP631,we compared the intracellular accumulation ... polyploidy and multinucleation instead of displaying signs of ÔclassicalÕ apoptosis as nuclearcondensation or DNA fragmentation. The differences in the kinetics of daunorubicin and WP631 uptake are ... field of cells obtained under the samemagnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline as uniquefluorophore in the microscopic assay. WP631...

Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc

... China and Denmark, but with bad luck in Nigeria and Ger-many and reﬂects ambition and desire in India.Some expressions involving colors share the same meaning across many languages. For in- stance, ... for machine translationas a source of paraphrasing.Color-concept-emotion associations also have the potential to enhance human- computer inter-actions in many real- and virtual-world domains,e.g., ... the tra-ditions and beliefs of a society. As shown in (Sable and Akcay, 2010) green represents danger in Malaysia, envy in Belgium, love and happiness in Japan; red is associated with luck in...

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... Microbiology, Post Graduate Institute of Medical Education and Research, Chandigarh, India 160012 3. Internal Medicine, Post Graduate Institute of Medical Education and Research, Chandigarh, India 160012 ... Teichoic acid and peptidoglycan are the major components of staphylococcal cell wall and they are known to induce inflammatory response in humans [29]. Antibodies against PG and TA antigens have ... syndrome in humans [14]. The data regarding the presence of antibodies during superficial S. aureus infections are not evaluated systematically. In this study we therefore aimed at analyzing antibody...

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... consisting of the morphemes of the same type, and does not in itself indicate any characteristics in the frame sample. 640 On the other hand, Pf and Rf express the quantitative status of the ... morphemes of each type as a mass in terminology. So the transi- tions of Pf and Rf, with changing N, express the changes of the status of the morphemes of each type in the terminology. In terminology, ... kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quantitative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese technical terms, the...

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan-guage model adaptation are both examples of re-ranking. In these tasks, we assume that we have ... re-rank the candidate list using additional features which may or may not be included in the baseline model. Since the mapping from  to  by the linear model may make use of arbitrary global ... first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of these estimators to two additional...

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... descriptive, naming parts in terms of their function and relation to other parts, and also describing the status of parts and other objects in the sublanguage. Domain specific information can be used ... equipment failure messages had about one-half the number of sentences of the patient histories. 236 sentences in the medical domain were analyzed and 123 in the Navy domain. The statistics are ... A Computational Analysis of Complex Noun Phrmms in N,,vy Messages Elaine Marsh Navy Center for Applied Research in Artificial Intelligence Naval Research Laboratory - Code 7510 Washington,...

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... RNA-binding and cleavage assays were evaluated. A RNA binding assay of the different mutants wasperformed using native MS, as indicated above. In allcases, the relative binding percentages of ... (kid A5 5G)PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G)PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E)PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E)PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid...

Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

... is akin to characterizing a case of mayhem as a good crime: in both instances the adjective is incongruous. If, as a crowning handicap, we are asked to replace the vast capacity of the human ... Fitzgerald’s translation of the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the translator’s art as a good translation ... indicated by the failure signal and by the notations of the error types encountered. On the other hand, the satisfaction of the criteria is no guar- antee that the result is a faithful translation,...

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... variety of thematicroles. Zapirain et al. (2008) evaluated PropBankARG tags and VerbNetthematic roles in a state -of- the- art SRL system, and concluded that PropBankARG tags achieved a more ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 19–27,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP A Comparative Study on Generalization of ... seman-tic representations, SRL has attracted much at-tention from researchers into various NLP appli-cations including question answering (Narayanan and Harabagiu, 2004; Shen and Lapata, 2007;buy.v...

Xem thêm