0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

... the otherhand, the importin a family generally binds to both the nuclear import cargo and importin b, indicatingthat importin a functions as an adaptor between the cargo proteins and importin ... 2011 The Authors Journal compilation ª 2011 FEBS Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery Tetsuji Moriyama1, Masahiro Nagai2, ... the basis of their sequencehomology. The importin a1 subfamily in mice consists of importin a1 (karyopherin a2 , PTAC58, Rch1); the importin a3 subfamily includes importin a3 (karyoph-erin a4 ,...
  • 12
  • 346
  • 0
Báo cáo khoa học: CXXC finger protein 1 restricts the Setd1A histone H3K4 methyltransferase complex to euchromatin doc

Báo cáo khoa học: CXXC finger protein 1 restricts the Setd1A histone H3K4 methyltransferase complex to euchromatin doc

... T32AI060519 and a Department of Education traininggrant in Graduate Assistance in Areas of NationalNeed (GAANN).References1 Peterson CL & Laniel MA (2004) Histones and histonemodifications. ... Epstein JA, Walsh MJ et al.(2008) Transcription factor AP2delta associates withAsh2l and ALR, a trithorax family histonemethyltransferase to activate Hoxc8 transcription. ProcNatl Acad Sci USA ... C-terminal deletion fragment of Cfp1 that lacks PHD2 (amino acids 1–481), or anN-terminal deletion fragment that lacks PHD1, the CXXC domain and the acidic domain (aminoacids 302–656), leads to...
  • 14
  • 321
  • 0
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

... Alternaria alternata 102 was kindly provided byK Takatori (National Institute of Health Sciences, Tokyo,Japan). A. alternata 102 maintained on a PDA slant(potato dextrose agar; Franklin Lakes, ... Laminaripentaose, N-acetylchito-octaose and glycolchitin remained inactive. Laminarinand the AaGlucan triggered a similar level of chitinaseactivity. However, laminarin was applied at a concen-tration ... without the enzyme orAaGlucan. Lane 2: AaGlucan without laminarinase treatment. Lane3: Laminarinase-treated AaGlucan. (B) Effect of periodate oxidationon the elicitor activities of AaGlucan (100...
  • 11
  • 358
  • 0
Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

... resulted in the total loss of thisactivity when assayed in the usual way, i.e. after addition of H2, a catalytic amount of NADH and the subsequentaddition of BV. Restoration of this activity (to ... reduction was, however, the same for all enzymesamples used in this study. As outlined in the present paper, the variable hydrogenase activities can be ascribed in part to the lack of FMN -a in a portion ... (reductionindicated as dashed pattern) by NADH (via FMN-b) induces aninstantaneous activation of the Ni-Fe site (removal of the OH–ligandfrom nickel) enabling the interaction with H2.AslongasFMN-aispresent,...
  • 8
  • 371
  • 0
Báo cáo khoa học: Distinguishing between different pathways of bilayer disruption by the related antimicrobial peptides cecropin B, B1 and B3 pptx

Báo cáo khoa học: Distinguishing between different pathways of bilayer disruption by the related antimicrobial peptides cecropin B, B1 and B3 pptx

... target specificity and may act on manymembrane types including those of erythrocytes (haemolyticactivity). For example, the synthesis of a variety of analogues of the 13-amino acid, tryptophan-rich ... aliquotswere placed in the bottom of a 1.5-cm diameter, 10-mL glasstube, and the solvent was dried at room temperature in a stream of argon gas, to provide a thin lipid film. Afterremoval of residual solvent ... analysis of the thermaltransitions that these peptide–lipid interactions generate andhas been shown to provide valuable information for the analysis of materials that destabilize membrane structure[54,55]....
  • 10
  • 443
  • 0
Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

... hormone to the N-terminal domain of the receptor translates into activation of its serpentine domain is unknown.With the aim of improving our understanding of the mechanisms underlying some of these ... relative abilities to stimulate the cAMP or IP regulatory cascades. Surprisingly the combination of a strong inactivating mutation with anactivating one produced a receptor that was able to ... Proper targeting and activity of a nonfunctioning thyroid-stimulatinghormone receptor (TSHr) combining an inactivating and activatingTSHr mutation in one receptorPatrizia Agretti1, Giuseppina...
  • 9
  • 499
  • 0
Báo cáo khoa học: 5-Bromodeoxyuridine induces transcription of repressed genes with disruption of nucleosome positioning pptx

Báo cáo khoa học: 5-Bromodeoxyuridine induces transcription of repressed genes with disruption of nucleosome positioning pptx

... explained by the absence of an activator function of Mcm1 in MATa cells. Mcm1 acts as an activator of a- cell-spe-cific genes in MATa cells, whereas it acts as a repressor in MATa cells. Taken together, ... WhendThdCDCBrdUCDC+++++++++ A dThdCDCBrdUCDC++++++B123 456 789 1011123′-CGTACATTAATGGCATTTTCCTTTAATGTAC-5′3′-GTACATTAAAGGAAAATGCCATTAATGTACG-5′Fig. 5. In vivo UV photofootprinting of a2 operator on pRS-BAR1.Intact ... (Fig. 2A, even-numbered lanes). The MNase cleavage pattern in a chromatin sample of pRS001-BAR1 was similar to that in the chromatinsample of pRS-BAR1 in dThd medium, although the bands *c and...
  • 10
  • 282
  • 0
Báo cáo khoa học: Modular metabolic control analysis of large responses The general case for two modules and one linking intermediate docx

Báo cáo khoa học: Modular metabolic control analysis of large responses The general case for two modules and one linking intermediate docx

... thathas produced the rate change. The parameter can act in any reaction of the module and can affect the rate of the reaction in any functional way. This approach isinspired in the one proposed ... varying the ATP ⁄ ADP ratio andmeasuring the supply and demand rates independently. The decrease in the ATP ⁄ ADP ratio was achieved byoverexpressing the hydrolytic part of the F1 domain of the ... by manipulating the activity of demand. The impossibility of increasing the flux by changing the activity of a single module is due to an abrupt decrease of the control of the moduleswhen their...
  • 14
  • 311
  • 0
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... were also analyzed according to the Scatchard method[47]. Linear regression analyses of binding data gave dissoci-ation constants (Kd), calculated from the reciprocal of the slopes. Association ... binding data were analyzed either bynonlinear regression analysis or by the method of Scat-chard. Nonlinear regression analysis of data from indi-vidual binding curves indicated that the data weredescribed ... aimed at characterizing the bind-ing of PCSK9 to intact cells by using radiolabeledPCSK9. Several observations indicate that LDLR is the main surface receptor mediating PCSK9 binding to HepG2...
  • 13
  • 712
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCGCGTGAACCGGAGTT ACCCGATGATAGGCTTCY11 5A CGCTGGAAACCTCTTGG GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D ... AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG ... TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W...
  • 10
  • 563
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ