0
  1. Trang chủ >
  2. Y Tế - Sức Khỏe >
  3. Sức khỏe phụ nữ >

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

... for the treatment of stress urinary incontinence in women: a systematic review Patricia B Neumann1, Karen A Grimmer*2 and Yamini Deenadayalan3Address: 1PhD candidate, School of Health ... University of South Australia, Adelaide, AustraliaEmail: Patricia B Neumann - cpneumann@ozemail.com.au; Karen A Grimmer* - karen.grimmer@unisa.edu.au; Yamini Deenadayalan - yamini.deenadayalan@unisa.edu.au* ... community-dwelling women over the age of 18 years in Australia [3]. The personal financial costs for women managing UI in Australia in 1998 were estimated at A$ 372 million perannum and the total annual...
  • 28
  • 738
  • 0
Board Engagement, Training and Reporting: Strategies for the Chief Ethics and Compliance Officer pptx

Board Engagement, Training and Reporting: Strategies for the Chief Ethics and Compliance Officer pptx

... combine both reporting and training in a single session. In fact, some of the best “stealth training can be delivered in the context of a Board report. For instance, while reviewing the status ... of the C&E program? What is the method and frequency of C&E reporting to the board, and of board contact with the CECO? 4. How will the board obtain and evaluate the appropriate training ... environmental have always brought important data to the Board and it is at the heart of the Board’s role to review and evaluate the data, ask hard questions. The focus should be: 1) what does the board...
  • 30
  • 434
  • 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

... extrapolated from data in the RCT. The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT. The data from the ... comparators in the studies cannot be considered current standard practice in the NHS in England and Wales because the 5-FU treatment schedules involved administration by bolus rather than administration ... largest study was lower than the age of patients normally receiving chemotherapy in England and Wales. However, clinical specialists agreed that fitness, rather than age, is the primary factor...
  • 34
  • 853
  • 0
Tài liệu Closing the gap between research and practice: Foundations for the acquisition of literacy pptx

Tài liệu Closing the gap between research and practice: Foundations for the acquisition of literacy pptx

... sourcesPage24CURRENT APPROACHES TO THE TEACHING OF READING IN AUSTRALIA16 A more detailed analysis of the philosophy and practice of whole language teaching in Australia and NewZealand is ... holistic and wholelanguage approaches to the teaching of reading from approaches based on skill-based or direct teaching models. The dominance of a single approach to the teaching of reading in Australia ... towhich the impact of this seminar and the research traditions it authoriseddominated Australian language and Page10FOCUS OF AUSTRALIAN RESEARCH INTOLANGUAGE AND LITERACY3It is of some interest...
  • 46
  • 1,122
  • 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... a- T, TA and TN (Figs 3 and 4), butnot of the antioxidants BHA and AsA. These resultssuggested that active oxygens and free radicals did notparticipate in the TS effect, and that the inhibitory ... 378S–381S.7. Badamchian, M., Spangelo, B.L., Bao, Y., Hagiwara, Y.,Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulatesrelease ... cellsKentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa1Faculty of Pharmaceutical Sciences, University of Tokushima, Japan The effect of a- tocopheryl...
  • 6
  • 494
  • 0
Báo cáo y học:

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

... the treatment of chronic back pain originating in the facet joint. MATERIALS AND METHODS Patient enrollment and evaluation All patients treated with endoscopic facet de-bridement at our institution ... Length of fol-low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho-racic in 15, and lumbar in 114 patients. Surgical times varied based on the ... compared to radiofrequency ablation of the dorsal nerve branch, with durable results. Large scale, randomized trials are warranted to further evaluate the relative efficacy of this surgical treatment...
  • 4
  • 599
  • 0
Báo cáo y học:

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

... or foraminal, refractory to conservative management is uncertain. We aimed to evaluate the efficacy of endoscopic laminoforamino-plasty (ELFP) in the treatment of thoracic radiculopathy. Methods: ... 225central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch. Materials and Methods Twelve patients were treated with endoscopic laminoforaminoplasty ... radiculopathy, laminoforaminoplasty, minimally invasive, endoscopic, spi-nal stenosis Introduction Radicular back pain is an important public health issue that can result in long term disability and...
  • 3
  • 506
  • 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

... 2003. The effective reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank. Influent was 60L/day. pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic ... to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter ... FISH analysis and was stored at -80oC. The extraction of DNA was performed with Fast DNA SPIN Kit for Soil (Qbuiogene, USA) according to the instruction by the manufacturer. In the preliminary...
  • 8
  • 572
  • 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

... which affect China’s environmental quality and the sustainable development. Municipal wastewater treatment in China faces serious shortage of financing and land area. Thus, considering the municipal ... NH4+-N removal and ±15% fluctuation in the PO43--P removal. An increase in the recycle ratio resulted in an increase in the COD removal and an increase in NH4+-N and PO43--P removals (Fig. ... tank. From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the adsorption tank and SRT of the system...
  • 8
  • 686
  • 0
Hydroxyurea for the Treatment of Sickle Cell Disease docx

Hydroxyurea for the Treatment of Sickle Cell Disease docx

... about the interactions between hydroxyurea and these underlying diseases, and between hydroxyurea and therapies for these diseases. Further research on the place of hydroxyurea in therapy and ... guidelines regarding its use, the National Institutes of Health Office of Medical Applications of Research (OMAR) and the Agency for Healthcare Research and Quality (AHRQ) requested that the ... pathways that are not yet fully characterized. One pathway is probably saturable hepatic metabolism, and another minor pathway may involve degradation by the urease found in intestinal bacteria....
  • 298
  • 1,113
  • 0

Xem thêm

Từ khóa: novel alternative therapies for the treatment of severe aortic stenosiscpg dna based therapies for the treatment of allergic disease1 25 dihydroxyvitamin d3 and its analogues for the treatment of psoriasismedical non surgical therapies for the treatment of angina pectorisleal y a flores l l garcía cortés l b cedillo rivera r and torres j 2008 antibody based detection tests for the diagnosis of helicobacter pylori infection in children a meta analysis plos one 3 e3751pelvic floor muscle trainingsacral nerve root stimulation for the treatment of pelvic and rectal painfetal and environmental basis for the cause of parkinson s disease3a program and project management for the acquisition of capital assets and doe m 413 3 1 project management for the acquisition of capital assets and doe std 1189 2008 integration of safety into the design processlipid involvement in viral infections present and future perspectives for the design of antivirneuronal insulin receptor signaling a potential target for the treatment of cognitive and moodadalimumab etanercept and infliximab for the treatment of rheumatoid arthritis nice technology appraisal guidance 130and old strategies for the design of antibacterial screening librariesmedication development for the treatment of cocaine addiction progress at preclinical and clinproposals for the treatment of users of alcohol and other drugs a psychoanalytic readingBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015