Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax)John C. Achenbach1,* and K. Vanya Ewart21Department of Biochemistry ... may be relevant tothe calculation of smelt AFP activity. The activity of smelt AFP is about one-third of that of sea raven AFP on a monomer concentration basis [11]. As sea raven and herringAFPs ... with a kmax of 343 n m from % 30 lMsamples of both untreated (Fig. 4A) Fig. 2. Analysis of antifreeze a ctivity. Antifreeze activity was evaluatedqualitatively by monitoring ice crystal morphology...

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

... data of A ˚kerfeldt et al. [29] agreeswith the large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter workrevealed that EF-hands II and VI of Calb ... products of CR I–II. We thank Walter Chazin (VanderbiltUniversity, Nashville) for critical evaluation of the manuscript and Barbara Zarzycka (Warsaw) for her technical assistance. This work wassupported ... Patrick Groves1, Attila Ambrus2,*, Agata Kaleta1, Katalin E. Ko¨ve´r3, Gyula Batta4 and Jacek Kuz´nicki1,51Department of Molecular and Cellular Neurobiology, Nencki Institute of...

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungﬁsh (Lepidosiren paradoxa) docx

... [13].Chromatographic analysisGel-ﬁltration analysis of pure calhepatin was performed asdescribed by Drohat et al. [7] by FPLC on a Superose 12HR 10/30 column (Pharmacia) calibrated with standardproteins. ... triﬂuoroacetic acid] over 80 min.Amino-acid analysis and sequencingPeptide amino-acid analyses and automatic amino-acidsequence determination by Edman degradation were carriedout in an Applied ... thaliana,Zea mays, Glycine max, Dunaliella tertiolecta, Picea mari-ana, Solanum tuberosum, Plasmodium falciparum and otherspecies. In addition, calmodulin-like proteins from A. thali-ana, Z....

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... efficiency of Iba1 and Iba2 or in the overall morphology of the generatedfilament bundles.Calcium affinity of Iba1 and Iba2Homodimerization and actin binding of Iba1 and Iba2were similar in the absence ... 1 and 2). The core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands 1 and 2,each consisting of two a helices (aA, aB and aC, aD,respectively) flanking a loop region able to bind calciumions ... 29–37.7 Utans U, Arceci RJ, Yamashita Y & Russell ME(1995) Cloning and characterization of allograft inflam-matory factor-1: a novel macrophage factor identified inrat cardiac allografts with chronic...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... microscopy data for serotypes hAd3 and hAd12 and the crystallographic data for hAd2raise the possibility that the hypervariable loop couldpossess secondary structural elements potentiallyimportant ... ¢-TCCGAAACCAGCG GCCGCTTTATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and thereverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAAAGTGCGGCTCGAT-3¢ were used to introduce a Not1 sitefollowed by the hAd12pb hypervariable ... formation involvescontacts throughout the polypeptide chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of ...

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... theyeast two-hybrid assay and using a mammalian hybridsystem (Invitrogen, Carlsbad, CA) (EDA Wheeler &V Ayyavoo, unpublished data). A blast searchrevealed that the IMAGE clone, localized ... contain a KHdomain. RNA analysis and blast analysis indicatedthat homologs and orthologs of VBARP exist, indica-ting the presence of VBARP in diverse phyla such asplants, yeast, and eukaryotes. ... A. Wheeler1, Ansuman Chattopadhyay2,Biswanath Majumder1, Jeremy DeRicco1, Elizabeth A. Schafer1 and Velpandi Ayyavoo11 Department of Infectious Diseases & Microbiology, Graduate...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... protein crystallography. Acta Crystallogr D Biol Crystallogr 50,760–763.31 Vagin A & Teplyakov A (2000) An approach to multi-copy search in molecular replacement. Acta CrystallogrD Biol Crystallogr ... Biochemistry 45, 6615–6627.24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthineguanine phosphoribosyltransferase expands substratespecificity. Arch ... Using a thermal-melt assay, a nucleo-tide metabolome library was screened against PRTFDC1 and revealed thathypoxanthine and guanine specifically interacted with the enzyme. It wassubsequently confirmed...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... coordinated by the carboxyl oxygenatoms of D8, D9, by the carboxamide oxygen of N92,by the hydroxyl oxygen of S39 and by the oxygenatoms of two water molecules, and has an approximateoctahedral ... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of ... and Pcm. l-isoaspartate O-methyltransferaseconverts isoapartyl residues to l-aspartyl residues and thereby repairs damaged proteins that can accumulatewith time in senescent cells. A copy of...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... Ureaplasmaparvum UMP kinase – a potential antibacterial drug targetLouise Egeblad-Welin1, Martin Welin2,*, Liya Wang1 and Staffan Eriksson11 Department of Anatomy, Physiology and Biochemistry, ... determined, as observed by Fassy et al. [14], and avoids the complication of potential UTP formation. Thecoupling enzymes (pyruvate kinase and lactate dehydroge-nase) were tested with ADP and UDP, and ... wasmutated to Asn or Ala. The mutant enzymes, F133N and F13 3A, were expressed, puriﬁed and characterized.With 1 mm UMP and ATP as substrates, the activities of F133N and F13 3A were only 50 and...

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... logarithmic earlystationary phase (days 3–5) and stationary phase (day 6). (A, B) TheRNAs (20 lg per lane) were loaded onto agarose gel, separated byelectrophoresis and transferred to a nylon ... disappearance was measured spectrophotometri-cally at 340 nm in a coupled enzyme assay to pyruvatekinase and lactate dehydrogenase at 30 °C. The assaymixture contained, in a total volume of ... estimated byusing the method of Bradford [25]. For analysis of enzymekinetics AK assay was done at varying concentrations of ATP and AMP and the results were analysed by doublereciprocal Lineweaver–Burk...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM