0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

Báo cáo khoa học:

Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

... What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information Darren Gergle Human-Computer Interaction Institute School of Computer ... referring behavior in shared visual contexts. First, a model of refer-ring behavior that integrates a component of shared visual information can be used to increase the robustness of interactive ... in the presence (or absence) of shared visual information. A successful computa-tional model of referring behavior in the pres-ence of visual information could enable agents to emulate many...
  • 8
  • 567
  • 0
Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

... discovered as one of the autoantigensfor the autoantibodies from a patient with collagenvascular disease [18]. MAN1 is an integral membraneprotein of the INM and belongs to the LEM (Lap2-emerin-MAN1)-domain ... WHdomain binds DNA with nanomolar affinity and the binding is further increased by the presence of the UHM domain [44]. Because the DNA binding site onMAN1 does not overlap with the Smad binding ... eventually lead to enhanced dephosphorylation of Smads and attenu-ated ⁄ terminated signal. The discovery that the INM protein MAN1 bindsSmads and antagonizes cytokine signaling also raisesthe...
  • 9
  • 704
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx

... Events, and Relations An important property of a natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. ... Since contexts are introduced as a new class of objects in the language, we can quantify over them and otherwise talk about them. In particular, we can organize contexts into a lattice-like structure ... ourselves to binary relations, we can generalize our representation by introducing the predicate ROLE and making rolenames into individuals in the domain. ROLE(o, r, v) asserts that individual...
  • 9
  • 483
  • 0
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

... [70]. In all of the cases described above, mainly histidyl–FAD-containing enzymes, it appears that the func-tional benefit of acquiring and retaining a covalentflavin–protein link is to increase the ... artifi-cial covalent flavinylation (again, FAD is linked via an8-carbon rather than 8a- carbon linkage) resulted in anincreased kcatvalue with d-alanine from 1.5 s)1for the mutant enzyme, containing ... of binding fold. With regard to the latter, in most VAO-type covalent flavoproteins, the flavin is covalently linked to an amino acid that ispart of the FAD-binding domain, whereas in VAO, the corresponding...
  • 23
  • 564
  • 0
Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

... beenfound as major colorants in the scleractinian coralsM. cavernosa, Scolymia cubensis, Catalaphyllia jardinei, the corallimorpharian Ricordia florida and the alcyo-narian Dendronepthya sp. [10,12,27]. ... suggest that the animals face considerableenergy costs maintaining such high expression levels,at least, if protein turnover is fast. To date, no kineticdata are available on the degradation of GFP-like ... exponential decay func-tions. The variability in half-life values was estimatedfrom the maximal deviation of the individual timepoints. We obtained half-lives of mcavRFP of 13 ± 2days in green...
  • 10
  • 487
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Combining Multiple Resources to Improve SMT-based Paraphrasing Model∗" pdf

... phrases to alleviatedata sparseness. Kauchak and Barzilay (2006) usedparaphrases of the reference translations to improveautomatic MT evaluation. In QA, Lin and Pantel(2001) and Ravichandran ... syntacticand context constraints in paraphrase generation to enhance the acceptability of the paraphrases. In ad-dition, we will extract paraphrase patterns that con-tain more structural variation ... Ravichandran and Hovy (2002) para-phrased the answer patterns to enhance the recall of answer extraction. In IE, Shinyama et al. (2002)automatically learned paraphrases of IE patterns to reduce the...
  • 9
  • 331
  • 0
Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

... NEMO adaptorbridges the nuclear factor-kappaB and interferonregulatory factor signaling pathways. Nat Immunol 8,592–600.73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C ... trimers in the plasma mem-brane early after receptor ligation whereas the celldeath regulators FAS-associated via death domain(FADD) and caspase 8 are recruited to a pro-apopto-tic complex that ... FADD, FAS-associated via death domain;IjBa, inhibitor of kappaB alpha; IKK, IjB kinase; NEMO, NF-jB essential modulator; NF-jB, nuclear factor kappaB; RIP1, receptor-interactingprotein 1; RIP3,...
  • 11
  • 503
  • 0
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

... calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation pro-file above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). As there is a positive and a negative set that both sample well the amino acidspace ... natural amino acids (a3 v). Next, calculations are based on the sliding-win-dow averaging technique: a sliding window of a givenlength is chosen and the program calculates the aver-age of a3 v values...
  • 8
  • 415
  • 0
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... ACTCAAGGGATTGTAGCCTTCCGGCAGCATCTACAGAATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAGGAACCCCTTGGTCCTCGCGAGATTCTGTAGATGCTGCCGGAAGGCTACAATCCCTTGAGTGAGAGACGTATC and 5¢-GATACGTCCCTTACACAAGGACTTAAGGCATTTAGACAACAGCTTCGGAAGAATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAATCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTGTCTAAATGCCTTAAGTCCTTGTGTAAGGGACGTATC, ... 5¢-GCGAGGACCAAGGGGATTCTGGAGCTGAACAAGGTGCAATTGTTGTACGAACAGGTGTGCCAGTCCTCC/5¢-GGAGGACTGGCACACCTGTTCGTACAATAATTGCACCTTGTTCAGCTCCAGAATCCCCTTTGGCCTCGC and 5 ¢-CTTGCTAGAACCAAAGGATTTCTGGGGTTGAACAAAATAAAAGGGCTGGCTCGGCAAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTGATCCCATTTGTCGAGC CAGCCCTTTTATTTTGTTCAACCCCAGAAATCCTTTGGTTCTAGCAAG. The ... 5¢-AAAGAATTCCTGTGGCAGGGGACCAGTGG; 708R: 5¢-AAAGAATTCGGGCTGGAGGAGGGGCGTTG; 632R: 5¢-AAAGAATTCCGGGGTGTGGAAGGTACTCA; 572R: 5¢-AAAGAATTCCTCCTGGAAGCTGACAGG; 341R: 5¢-AAAGAATTCGAGCAGGAGGTAGTAAAT; the EcoRI...
  • 13
  • 440
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "That’s What She Said: Double Entendre Identification" doc

... cap-italizing the first letter of each sentence, tagging itwith the Stanford Parser (Toutanova and Manning,2000; Toutanova et al., 2003), and fixing several tag-ger errors (e.g., changing the tag of ... classifier. DEviaNT sets the cost of a false positive to be 100 times that of a falsenegative.4 Evaluation The goal of our evaluation is somewhat unusual.DEviaNT explores a particular approach ... (Mason, 2004; Shutova, 2010). Other ap-proaches train support vector machine (SVM) mod-els on labeled training data to distinguish metaphoriclanguage from literal language (Pasanek and Scul-ley,...
  • 6
  • 268
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP