Eur J Biochem 271, 4307–4319 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04372.x Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm Yoshiko Katoh1,*, Hiroshi Takemori1, Li Min1, Masaaki Muraoka1,3, Junko Doi4, Nanao Horike1 and Mitsuhiro Okamoto1,2 Department of Biochemistry and Molecular Biology, Graduate School of Medicine (H-1) and 2Laboratories for Biomolecular Networks, Graduate School of Frontier Biosciences, Osaka University, Japan; 3ProteinExpress Co., Ltd, Choshi, Chiba, Japan; Department of Food and Nutrition, Senri Kinran University, Osaka, Japan Salt-inducible kinase-1 (SIK1) is phosphorylated at Ser577 by protein kinase A in adrenocorticotropic hormone-stimulated Y1 cells, and the phospho-SIK1 translocates from the nucleus to the cytoplasm The phospho-SIK1 is dephosphorylated in the cytoplasm and re-enters the nucleus several hours later By using green-fluorescent protein-tagged SIK1 fragments, we found that a peptide region (586– 612) was responsible for the nuclear localization of SIK1 The region was named the ÔRK-rich regionÕ because of its Arg- and Lys-rich nature SIK1s mutated in the RK-rich region were localized mainly in the cytoplasm Because SIK1 represses cAMP-response element (CRE)-mediated transcription of steroidogenic genes, the mutants were examined for their effect on transcription To our surprise, the cytoplasmic mutants strongly repressed the CRE-binding protein (CREB) activity, the extent of repression being similar to that of SIK1(S577A), a mutant localized exclusively in the nucleus Several chimeras were constructed from SIK1 and from its isoform SIK2, which was localized mainly in the cytoplasm, and they were examined for intracellular localization as well as CREB-repression activity A SIK1-derived chimera, where the RK-rich region had been replaced with the corresponding region of SIK2, was found in the cytoplasm, its CREB-modulating activity being similar to Correspondence to M Okamoto, Department of Biochemistry and Molecular Biology, Graduate School of Medicine (H-1), Osaka University 2-2 Yamadaoka, Suita, Osaka, 565-0871 Japan Fax: +81 6879 3289, Tel.: +81 6879 3280, E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp Abbreviations: ACTH, adrenocorticotropic hormone; b-ZIP, basic leucine zipper domain; C, cytoplasm; CRE, cAMP-response element; CREB, CRE-binding protein; DAPI, 4¢,6-diamidino-2-phenylindole; FITC, fluorescein-5-isothiocyanate; FRAP, FKBP12-rapamycinassociated protein kinase; GFP, green fluorescent protein; GST, glutathione S-transferase; HA, haemagglutinin; MAPK, mitogenactivated protein kinase; MK5, MAPK-activated protein kinase 5; N, nucleus; NES, nuclear export signal; NLS, nuclear localization signal; PKA, protein kinase A; SIK, salt-inducible kinase; TORC, transducer of regulated CREB activity *Note: Yoshiko Katoh is a research fellow of the Japan Society for the Promotion of Science (Received June 2004, revised 26 August 2004, accepted 21 September 2004) that of wild-type SIK1 On the other hand, a SIK2-derived chimera with the RK-rich region of SIK1 was localized in both the nucleus and the cytoplasm, and had a CREBrepressing activity similar to that of the wild-type SIK2 Green fluorescent protein-fused transducer of regulated CREB activity (TORC2), a CREB-specific co-activator, was localized in the cytoplasm and nucleus of Y1 cells, and, after treatment with adrenocorticotropic hormone, cytoplasmic TORC2 entered the nucleus, activating CREB The SIK1 mutants, having a strong CRE-repressing activity, completely inhibited the adrenocorticotropic hormoneinduced nuclear entry of green fluorescent protein-fused TORC2 This suggests that SIK1 may regulate the intracellular movement of TORC2, and as a result modulates the CREB-dependent transcription activity Together, these results indicate that the RK-rich region of SIK1 is important for determining the nuclear localization and attenuating CREB-repressing activity, but the degree of the nuclear localization of SIK1 itself does not necessarily reflect the degree of SIK1-mediated CREB repression Keywords: cAMP; CRE; nuclear localization signal; SIK; transcription repression cAMP response element (CRE)-binding protein (CREB), a transcription factor involved in numerous physiological processes, regulates gene expression in a phosphorylationdependent manner [1–3] Ser133, the major transcription activation site of CREB, is phosphorylated by protein kinase A (PKA) [4,5], p38 mitogen-activated protein kinase (MAPK) [6], mitogen- and stress-activated protein kinase [7], pp90rsk [8], protein kinase B [9] and calcium-calmodulindependent kinase II/IV [10,11], whereas Ser142, the negative regulation site, is phosphorylated by calcium-calmodulindependent kinase II [12,13] The phosphorylation of Ser residues alters the affinity of CREB to CREB-binding protein and p300, and results in a change of the transcription efficiency [3,14–17] Several kinases, such as CPG16 [18] and leucine zipper protein kinase [19], even though they not phosphorylate CREB directly, are known to modulate CRE/CREB activity Salt-inducible kinase-1 (SIK1), a Ser/Thr protein kinase cloned from high-salt diet-fed rat adrenals [20], and also from PC12 pheochromocytoma cells induced by membrane Ó FEBS 2004 4308 Y Katoh et al (Eur J Biochem 271) depolarization [21], is a member of the sucrose nonfermenting-1 protein kinase/AMP-activated protein kinase family [22–26] SIK1 was found to be expressed in adrenocortical cells at an early phase of the adrenocorticotropic hormone (ACTH) stimulation [20,27] When overexpressed in Y1 cells, SIK1 repressed the expression of steroidogenic genes, such as side-chain cleavage cytochrome P450 and steroidogenic acute regulatory protein [27,28] Promoter analyses of these genes indicated that the CREs in these promoters were the sites for SIK1-mediated transcriptional repression and that SIK1 might repress CREB activity [28,29] Although SIK1 seemed not to phosphorylate CREB directly, it repressed CREB in a kinase activity-dependent manner The results of studies with several Gal4–fusion CREBs suggested that SIK1 repressed CREB by acting on the basic leucine zipper (b-ZIP) domain of CREB [29] SIK1 is found mainly in the nucleus of resting Y1 cells In ACTH-treated cells, SIK1 is phosphorylated at Ser577 by PKA, and the phospho-SIK1 moves to the cytoplasm within 10 The phospho-SIK1 is then dephosphorylated, and SIK1 re-enters the nucleus several hours later A period when SIK1 was not present in the nucleus appeared to coincide with that when the SIK1-dependent CREB-repression was not detected A mutant SIK1 (having Ala577) was exclusively present in the nucleus, and its CREB-repression activity was higher than that of the wild-type SIK1 [28,30] Based on these results, we conclude that the nuclear presence of SIK1 is important for the repression of CREB The recent isolation and characterization of an adiposespecific isoform, SIK2 [31], forced us to reconsider the relationship between intracellular localization and CREBrepression activity of SIKs SIK2 is localized mainly in the cytoplasm of mouse 3T3-L1 preadipocytes but represses CREB activity, although the degree of repression by SIK2 seems to be lower than that by SIK1 Therefore, we decided, first, to identify a domain(s) that determined the intracellular localization of SIK1 and, second, to examine its role in the CREB repression Our results indicated that a short peptide stretch (comprising residues 586–612), the RK-rich region, was important for the nuclear localization of SIK1 Surprisingly, the RK-rich region-defective SIK1 mutants, seen mainly in the cytoplasm, were able to repress the CREB-mediated transcription strongly Moreover, chimeras constructed from SIK1 and SIK2, having their RK-rich region and the corresponding region exchanged between the two enzymes, showed no correlation between their nuclear localization and CREB-repression activities On the other hand, both the nuclear and cytoplasmic SIK1 mutants inhibited the ACTH-induced nuclear entry of a CREBspecific co-activator, TORC2 (transducer of regulated CREB activity 2) We therefore concluded that SIKs, even present in the cytoplasm, could repress CREB-mediated gene expression, and the RK-rich region of SIK1 was important for not only the nuclear localization, but also the attenuation of CREB-repression activity serum and antibiotics, at 37 °C under an atmosphere of 5% CO2/95% air 3T3-L1 cells, obtained from Japan Health Sciences Foundation (Osaka, Japan), were maintained in DMEM, as described previously [31] 4¢,6-Diamidino-2phenylindole (DAPI) dilactate was from Molecular Probes, and fluorescein isothiocyanate (FITC)-conjugated anti-rat IgG was from Funakoshi (Tokyo, Japan) The method of reporter assays was as described previously [29] To introduce plasmids into cells, LipofectAMINE 2000 (Invitrogen Corp., Carlsbad, CA, USA) was used in this study Luciferase activities were measured by using the Dual-Luciferase Reporter Assay System (Promega Corp., Madison, WI, USA) For the CRE-reporter assay, Y1 cells (1 · 105 per well) were transfected with the SIK1 expression plasmid (pIRES-SIK1, pIRES-SIK1 mutants or pIRES empty vector: 0.2 lg), CRE-luciferase reporters [pTAL-CRE or pTAL (empty reporter) alone: 0.2 lg], the PKA expression plasmid (pIRES-PKA or pIRES: 0.1 lg) and pRL-SV40 (internal standard: 0.03 lg) For the CREB reporter assay, cells were transformed with Gal4 DNAbinding domain-linked CREB expression vectors [pMCREB(F), pM-CREB(S) or pM, empty vector: 0.15 lg], expression vectors for SIK1 mutants or empty expression vectors (pIRES-SIK1 or pIRES: 0.2 lg), the PKA expression vector or empty vector (pIRES-PKA or pIRES: 0.1 lg), and reporter vectors [GAL4-linked luciferase reporter (pTAL-5x GAL-4: 0.15 lg) and an internal control (pRL-SV40: 0.03 lg) Transformation efficiencies were corrected by Renilla luciferase activities The specific transcriptional activities derived from the CRE and CREB were expressed as fold-expression of the reporter activity of the empty vector, pTAL and pM, respectively For fluorescence microscopy observations, cells were cultured on poly-L-lysine coated coverslips (18 mm; Matsunami Co Ltd, Tokyo, Japan) in a 12-well dish Cells (< · 104) were transformed with 0.5 lg of GFP-SIK1 expression vector, incubated for 16 h and stimulated with or without ACTH (10)6 M) for h, fixed with mL of 4% paraformaldehyde dissolved in NaCl/Pi for 15 min, stained with DAPI [1 ngỈmL)1 in NaCl/Pi containing 0.01% (v/v) Triton X-100] for min, and then washed with NaCl/Pi four times Cells on the coverslip were embedded onto a glass slide using 50% (v/v) glycerol On average,  20–30% of the cells showed detectable GFP-SIK1 signals in independent triplicate experiments The majority of localization patterns of GFP-SIK1 was classified according to whether it was found extensively in the nucleus (N), was present at a higher level in the nucleus (N > C), was evenly distributed between the nucleus and the cytoplasm (N ¼ C), was present at a higher level in the cytoplasm (N < C) or was found extensively in the cytoplasm (C), for more than 200 cells To visualize haemagglutinin (HA)-tagged SIK1, rat anti-HA tagged IgG (Boehringer Mannheim Biochemicals Inc., Mannheim, Germany) and FITC-conjugated anti-rat IgG were used The transformation efficiency of GFP-tagged, as well as HA-tagged, proteins was always constant ( 20%) Materials and methods Plasmids Cell culture and reporter assay Y1 cells were maintained in DMEM (Dulbecco’s modified Eagle’s medium) (Sigma), containing 10% (v/v) fetal bovine cDNA fragments for rat SIK1 [27] and mouse SIK2 [31] were cloned into the green fluorescent protein (GFP) expression vector, pEGFP-C [28] For the reporter assay, the nontagged Ó FEBS 2004 Cytoplasmic SIK1 represses CREB (Eur J Biochem 271) 4309 expression vector, pIRES (B-E), was used The original pIRESneo1 vector (Clontech Laboratories Inc., Palo Alto, CA, USA) contained, in its cloning region, EcoRI and BamHI sites in a reverse order to that of the pEGFP-C vector So, BamHI and EcoRI sites in this order (B-E) were created using oligonucleotides at the NotI/BamHI site of vector pIRESneo1 The oligonucleotides used were 5¢-GGC CGGATCCGAATTC and 5¢-GATCGAATTCGGATCC cDNA fragments of C-terminal deletion SIK1s (1–740, 1–708, 1–632, 1–572, 1–341) were amplified by PCR using a common forward primer (5¢-AAAGGATCCATGGTGA TCATGTCGGAGTTC: the BamHI site is indicated by the underlined region) and each specific reverse primer (740R: 5¢-AAAGAATTCCTGTGGCAGGGGACCAGT GG; 708R: 5¢-AAAGAATTCGGGCTGGAGGAGGGG CGTTG; 632R: 5¢-AAAGAATTCCGGGGTGTGGAAG GTACTCA; 572R: 5¢-AAAGAATTCCTCCTGGAAGC TGACAGG; 341R: 5¢-AAAGAATTCGAGCAGGAGG TAGTAAAT; the EcoRI site is indicated by the underlined region) Similarly, N-terminal-deleted cDNA fragments were prepared by a common reverse primer (5¢-AAAGAATTC TCACTGTACCAGGACGAACGTCC: the EcoRI site is indicated by the underlined region) and specific forward primers (24F: 5¢-AAAGGATCCGTGGGCTTTTACGAC GTGGA; 163F: 5¢-AAAGGATCCATCAAGCTGGCAG ATTTTGGA; 342F: 5¢-AAAGGATCCGAGCGCCTCA GGGAGCATCGA; 571F: 5¢-AAAGGATCCCAGGA GGGACGGAGAGCG; 632F: 5¢-AAAGGATCCCCGG CCCCAAGCTCAGGTCTG; the BamHI site is indicated by the underlined region) Amplified cDNA fragments were digested by BamHI/EcoRI and ligated into the BamHI/ EcoRI site of vector pEGFP-C To prepare internal deletion mutants, cDNA fragments of the N-terminal regions and of the C-terminal regions were separately amplified by PCR and then ligated to these fragments To amplify fragments containing residues 1–572, 1–585 and 1–612, the common forward primer and specific reverse primers (572R: 5¢AAAGGGCCCCTCCTGGAAGCTGACAGG; 585R: 5¢AAAGGGCCCCAGCCCTTGAGTGAGAGA CG; 612R: 5¢AAAGGGCCCACGGGCCAATCCTTT GATCTTGTTCAG; the Bsp120I site is indicated by the underlined region) were used cDNA fragments containing residues 586–776, 613–776 and 632–776 were amplified by using the common reverse primer and specific primers (586F: AAAGGGCCCAAGGCCTCCCGGCAGCAG; 613F: AAAGGGCCCCAGGTGTGCCAGTCCTCCATC; 632F: AAAGGGCCCGCCCCAAGCTCAGGTCTG; the Bsp120I site is indicated by the underlined region) The cDNA fragments for the N-terminal regions and the C-terminal regions were digested with BamHI/Bsp120I and by EcoRI/Bsp120I, respectively, mixed at a ratio of : 1, and ligated into the BamHI/EcoRI site of vector pEGFP-C cDNA fragments encoding the RK-rich region were amplified by PCR by using the BamHI-linked 586F primer and EcoRI-linked 612R primer, digested by BamHI/EcoRI and ligated into the BamHI/EcoRI site of vector pEGFP-C GFP expression vectors, having T-antigen nuclear localization signal (NLS) and Rev-nuclear export signal (NES) sequences, were prepared by direct ligation of oligonucleotides at the NotI site of the pEGFP-C vector T-antigen NLS oligonucleotides were 5¢-GGCCATTCAAAGTA AAGAAGAAACGTAAGCCGT and 5¢-GGCCACG GCTTACGTTTCTTCTTTACTTTGAAT; Rev NES oligonucleotides were 5¢-GGCCTCTGCAGCTCCCGC CACTGGAACGTCTTACCCTCGACA and 5¢-GGCC TGTCGAGGGTAAGACGTTCCAGTGGCGGGAG CTGCAGA T-antigen NLS- and Rev-NES-inserted D586-612 SIK1 mutants were prepared by ligation of the above sets of oligonucleotides in the Bsp120I site of D586-612 Site-directed mutagenesis was carried out by using a kit, GeneEditor (Promega), according to the manufacturer’s protocol The following primers were used: SIK-1 (R593A/ K594A), 5¢-TTCCGGCAGCAGCTAGCGGCAAACG CGAGGACCAAG; SIK-1 (R597A/K599A), 5¢-CTAA GGAAAAACGCGGCGACCGCGGGGTTCCTGGGA CTG); SIK-1 (L602A/L604A), 5¢-AGGACCAAGGGG TTCGCGGGCGCCAACAAGATCAAAGGA); SIK-1 (K606A/K608A), 5¢-TTCCTGGGACTGAACGCGAT CGCCGGCTTGGCCCGTCAGGTG); SIK-1 (I607A/ L610A), 5¢-CTGGGACTGAACAAGGCCAAAGGCGC CGCCCGTCAGGTGTGC) To prepare chimeric SIK1 and SIK2 mutants whose domain 3Bs were exchanged, the Quick change Site-directed Mutagenesis Kit (Stratagene) was used Because the cDNA fragment of the domain 3B was too long to perform sitedirected mutagenesis, it was separated into 5¢ and 3¢ regions, and the mutagenesis was performed on the respective fragments The 5¢ fragments of the domain 3B from SIK1 and SIK2 were mutated with 5¢-GATACGTCTCTCACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTACACAAG GACTTAAGGCATTTAGACAACAGCTTCGGAAG AATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAA TCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTG TCTAAATGCCTTAAGTCCTTGTGTAAGGGACG TATC, respectively The 3¢ fragments of domain 3B from SIK1 and SIK2 were mutated with 5¢-GCGAGG ACCAAGGGGATTCTGGAGCTGAACAAGGTGC AATTGTTGTACGAACAGGTGTGCCAGTCCTCC/ 5¢-GGAGGACTGGCACACCTGTTCGTACAATAA TTGCACCTTGTTCAGCTCCAGAATCCCCTTTGGC CTCGC and 5¢-CTTGCTAGAACCAAAGGATTTCT GGGGTTGAACAAAATAAAAGGGCTGGCTCGGC AAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTG ATCCCATTTGTCGAGCCAGCCCTTTTATTTTGT TCAACCCCAGAAATCCTTTGGTTCTAGCAAG The mammalian expression vector, pCMVspor6, containing full-length mouse TORC2 (Clone ID: 5345301) cDNA, was purchased from Invitrogen Site-directed mutagenesis was used to introduce a BglII site at the 5¢ terminus of the cDNA The following primers were used: mTORC2 Bgl II-F, 5-GGCGGGGACGGACGCGGGAGATCTA TGGCGACGTCAGGG; mTORC2 Bgl II-R, 5-CCC TGACGTCGCCATAGATCTCCCGCGTCCGTCCCC GCC The resultant full-length mouse TORC2 cDNA was digested with BglII and NotI, and ligated into the BamHI/ NotI site of vector pEGFP-C 4310 Y Katoh et al (Eur J Biochem 271) Immunoprecipitation Immunoprecipitation was performed as described previously [27] Briefly, cells (5 · 105) plated on a 10 cm dish were transformed with lg of expression plasmids (pSVL-HA) for HA-tagged wild-type and mutant SIKs using lL of LipofectAMINE 2000 After 36 h of incubation, cells were lysed in 0.7 mL of lysis buffer [50 mM Tris/HCl (pH 8.0), 300 mM NaCl, mM EDTA, mM EGTA, mM dithiothreitol, 50 mM b-glycerol phosphate, 50 mM NaF, mM NaVO4, 0.5% Triton X-100, and protease inhibitor] HAtagged SIK protein was immunoprecipitated by using antiHA-tag IgG (2 lg) and protein G-Sepharose (30 lL) The aliquots of immunopurified SIK1 were subjected to Western blot analyses with anti-SIK1 IgG and in vitro kinase assays Purified SIKs were incubated with glutathione S-transferase (GST)-Syntide2 in the presence 0.5 lCi (18.5 kBq) of [32P]dATP[cP] at 30 °C for 30 The kinase reaction was stopped by adding 3· SDS sample buffer [150 mM Tris/ HCl (pH 6.8), 6% (v/v) SDS, 30% (v/v) glycerol, and 0.1% (v/v) bromophenol blue] and heating at 100 °C for The aliquots were subjected to 15% SDS/PAGE, and phosphorylated peptides were visualized by autoradiography Results Subcellular distribution of truncated SIK1s By using the GFP-fusion technique, we previously reported the phosphorylation-dependent nuclear export of SIK1 in ACTH-stimulated Y1 cells [28] When SIK1 was present in the nucleus, it was able to repress CREB activity However, a cytoplasmic isoform of SIK, SIK2 [31], forced us to reconsider correlation between the loss of CREB-repressing activity and the cytoplasmic localization of SIK1 To address to this problem, we decided to isolate SIK1 mutants, localized essentially in the cytoplasm, by modifying a region determining the nuclear localization of SIK1 When GFP-fused full-length SIK1 (i.e SIK1 with GFP at its N terminus) was expressed in unstimulated Y1 cells, the majority of GFP signals formed speckles in the nucleus, and the minority diffused into the cytoplasm (the left column in Fig 1A) The nuclear GFP–SIK1, however, was completely translocated to the cytoplasm after treatment with ACTH (the right column in Fig 1A) When GFP alone was expressed, the green fluorescence was present more extensively in the nucleus than the cytoplasm, with or without ACTH Although the GFP fusion technique would yield rapid results regarding the distribution of target molecules, we must consider, as a caveat, that the GFP protein tends to accumulate in the nucleus In any case, in the hope of determining domain(s) important for the intracellular localization, we first attempted to investigate the intracellular distribution of a number of GFP–SIK1 mutants with N- and C-terminal deletions Figure 1B illustrates areas in the primary sequence of SIK1 that altered the intracellular distribution of GFP–SIK1 fragments The distribution of SIK1(1–740) was similar to that of the full-length SIK1 When the region containing residues 709– 776 was deleted, the resultant SIK1(1–708) was localized only in the nucleus of Y1 cells and was not translocated to Ó FEBS 2004 the cytoplasm, even when the cells were stimulated with ACTH Similar results were obtained with SIK1(1–632) From these results, we surmise that the region containing residues 708–740 was important for the nuclear export of SIK1 When the C-terminal deletion reached residue 573, part of SIK1(1–572) was again found in the cytoplasm Similar results were obtained for SIK1(1–341) These results suggest that the region containing residues 572–632 might be important for the nuclear localization of SIK1 Considering that proteins of < 40–60 kDa molecular mass would enter the nucleus passively [32,33], the nuclear presence of GFP-SIK1(1–572) and GFP-SIK1(1–341), having molecular masses of 90 kDa and 66 kDa, respectively, suggest the presence of minor nuclear localization activities in the N-terminal fragment (1–572) Next, the subcellular distribution of N-terminus-deleted mutants was investigated The distribution of SIK1(24–776) was similar to that of full-length SIK1 On the other hand, SIK1(163–776) and SIK1(342–776) were localized only in the nucleus, and they failed to move to the cytoplasm in response to ACTH SIK1(571–776) was localized exclusively in the nucleus, suggesting the presence of an active nuclear localization signal in the region comprising residues 571–776 When the N-terminal deletion reached residue 631, the resultant SIK1(632–776) was diffusely distributed all over the cell Taken together, these results indicate that a major nuclear localization signal might exist in region 573–631 The region 573–631 does not contain a cluster of more than three successive basic residues, a feature often seen in typical nuclear localization signals, such as the unipartite basic cluster KKKRK of SV40 (simian virus 40) T-antigen [34] and the bipartite cluster RKR-Xn-RKRKR of T-cell protein tyrosine phosphatase [35] However, close examination revealed the presence in the region of a peptide stretch, Lys586-Ala-Phe-Arg-Gln-Gln-Leu-Arg-Lys-Asn-Ala-ArgThr-Lys-Gly-Phe-Leu-Gly-Leu-Asn-Lys-Ile-Lys-Gly-LeuAla-Arg612 (basic residues shown in bold), in which basic and hydrophobic residues were interspersed We named this stretch the ÔRK-rich region (586–612)Õ It should be noted that Ser577, an important residue for the phosphorylationdependent nuclear export of SIK1, exists near the RK-rich region Region 586–612, the RK-rich region, determines the intracellular localization of SIK1 To investigate further the role(s) played by the region 573– 631 for determining the intracellular distribution of SIK1, we created several mutants with deletions in this region Noting that the RK-rich region (586–612) was positioned in the centre of 573–631, we decided to split the region 573–631 into three parts – an N-terminal region (573–585), the RK-rich region (586–612), and a C-terminal region (613–631) – and produced four deletion mutants, shown in Fig 2A SIK1(D573–631), a mutant lacking the entire region, was distributed diffusely all over the cell with no response to ACTH SIK1(D573–585) was localized specifically in the nucleus with a weak response to ACTH However, SIK1(D586–612) (i.e the mutant minus the RK-rich region) was present mainly in the cytoplasm of resting Y1 cells, Ó FEBS 2004 Cytoplasmic SIK1 represses CREB (Eur J Biochem 271) 4311 A Fig Intracellular distribution of green fluorescent protein (GFP)-fusion salt-inducible kinase (SIK1) mutants (A) Y1 cells, cultured on coverslips and transformed with overexpression vectors for GFP-tagged SIK1 protein, were treated with or without adrenocorticotropic hormone (ACTH) (10)6 M) for h and fixed for fluorocytochemical analyses Green fluorescent signals of GFP-SIK1 (upper), and blue fluorescent signals representing nuclear staining with 4¢,6diamidino-2-phenylindole (DAPI) (middle), are shown The intracellular localization of GFP alone is shown in the bottom panels The patterns of the intracellular distribution of green fluorescent signals were classified into five groups (N, N > C, N ¼ C, N < C and C), as described in the Materials and methods, and representative pictures are shown (B) C-terminal- and N-terminal-deleted SIK1 mutants were expressed in Y1 cells The wildtype SIK1 (Full) contains amino acids 1–776 The kinase domain (27–278) is in the N-terminal half, whereas the region essential for nuclear localization (573–631) is in the C-terminal half The Arg/Lys-rich region (RK-rich region) is shown as a black box B although found to a minor extent in the nucleus, and was translocated completely to the cytoplasm after stimulation with ACTH SIK1(D613–631) behaved similarly to wildtype SIK1 Whether the RK-rich peptide alone has nuclear translocation activity was tested by using the GFP-fused RK-rich peptide As shown in Fig 2B, GFP-SIK(586–612) was localized only in the nucleus (Note that GFP alone was distributed diffusely all over the cell, as shown in Fig 1A.) In the control experiments, the GFP-linked SV40 T-antigen nuclear localization signal (NLS), KKKRK (basic residues in bold) [34] was found only in the nucleus, while the GFPlinked HIV-1 Rev protein nuclear export signal (NES), LGLPPLERLTLD (hydrophobic residues in bold) [36], was found only in the cytoplasm These results indicated that the RK-rich region might be important for the nuclear localization of SIK1 Basic residues in the RK-rich region (586–612) were replaced with Ala, and the intracellular distribution of mutants was examined (Fig 3A) SIK1(R593A/K594A), SIK1(R597A/K599A) and SIK1(K606A/K608A) were found mainly in the cytoplasm of resting Y1 cells When the cells were treated with ACTH, those mutants were translocated to the cytoplasm These results suggested that the basic residues in the RK-rich region might be important for the nuclear localization of SIK1 Next, bulky hydrophobic residues, such as Leu and Ile, were replaced with Ala, and the intracellular distribution of mutants was investigated (Fig 3A) SIK1(L602A/L604A) was distributed diffusely both to the nucleus and to the cytoplasm of resting Y1 cells On the other hand, SIK1(I607A/L610A) was localized mainly in the cytoplasm These findings suggest that these hydrophobic residues, too, might have an important role for the nuclear localization Based on the above findings, we attempted to prepare SIK1 mutants that would be predicted to localize exclusively either in the nucleus or in the cytoplasm Hence, either canonical SV40 T-antigen NLS or Rev NES was inserted into the deleted part of SIK1(D586–612) (Fig 3B) SIK1(D586–612 + NLS) was accumulated more in the nucleus than the parent SIK1(D586–612), and, when the cells were stimulated with ACTH, SIK1(D586– 612 + NLS) was translocated to the cytoplasm (Fig 3A) 4312 Y Katoh et al (Eur J Biochem 271) Ó FEBS 2004 A B By contrast, SIK1(D586–612 + NES) was found exclusively in the cytoplasm of both resting and ACTH-treated Y1 cells Thus, the T-antigen NLS could be replaced with the RK-rich region as the nuclear localization signal, while the Rev NES, if inserted into SIK1(D586–612), could function as the nuclear export signal We also produced an unphosphorylatable SIK1(D586– 612) mutant, in which Ser577 was replaced with Ala As expected, the nuclear accumulation of SIK1(D586– 612 + S577A) was higher than that of parent mutant SIK1(D586–612) and was influenced a little by ACTH treatment On the other hand, SIK1(S577A), the nuclear export-defective mutant, was localized only in the nucleus, as reported previously [28] A comparison between the intracellular distribution of SIK1(D586–612/S577A) and that of SIK1(S577A) again highlights the importance of the RK-rich region as the nuclear localization signal The RK-rich region of SIK1 and the corresponding region of SIK2 determine the intracellular localization The above results suggest that the intact RK-rich region is an important determinant for the nuclear localization of SIK1 Before proceeding to investigate the CREB-repressing activity of these cytoplasmic SIK mutants, we focused our attention on SIK2, an adipose-specific isoform of SIK1 SIK2, having a similar, but distinct, amino acid sequence in a region corresponding to the RK-rich region (Fig 4A,B), was localized mainly in the cytoplasm of 3T3L1 mouse preadipocytes [31,37] Alignment of the two isoforms indicates that they have three highly conserved domains (Fig 4A) Protein kinase structures are present in domain 1, and the function of domain remains to be explored Domain shares 73% identical amino acid residues between the two isoforms Domain 3A, the N-terminal half, contains a PKA-dependent phosphory- Fig The RK-rich region is essential for the nuclear localization of salt-inducible kinase (SIK1) (A) An overall structure of green fluorescent protein (GFP)-SIK1 is shown at the top Ser577 is the residue that is phosphorylated by protein kinase A (PKA) when the cells are stimulated The intracellular distribution of SIK1 mutants containing the deletion in the RK-rich region were investigated as described in the legend to Fig and in the Materials and methods (B) The GFPfused RK-rich region nuclear localization signal (NLS) (KKKRK) of SV40 (Simian virus 40) T-antigen, and nuclear export signal (NES) (LGLPPLERLTLD) of the HIV-1 Rev protein were expressed, and their intracellular distribution were investigated latable Ser (Ser577 in SIK1 and Ser587 in SIK2, respectively), whereas domain 3B, the C-terminal half, corresponds to the RK-rich region and its equivalent (Fig 4B) The similarity of domain 3B between the two isofoms is lower than that of domain 3A Notably, five of nine basic residues present in the RK-rich region are replaced with other residues in the corresponding region of SIK2 To examine whether or not the lower similarity in domain 3B between the two isoforms contributes to the difference in their intracellular distribution, two chimeras, each having its domain 3B replaced with that of the other isoform, were constructed and expressed in Y1 cells (Fig 4C) Chimera 1, SIK1, in which RK-rich region had been replaced with domain 3B of SIK2, was localized less in the nucleus than the wild-type SIK1 (see the difference between the first and second panels in Fig 4C) On the other hand, Chimera 2, SIK2, in which domain 3B had been replaced with the RK-rich region, was localized more in the nucleus than the wild-type SIK2 (see the difference between panels and in Fig 4C) The treatment of Y1 cells with ACTH seemed to induce the nuclear export of these chimeras When Ser577 of Chimera was mutated to Ala, a substantial amount of the mutant was retained in the nucleus after treatment with ACTH (see the difference between panels and in Fig 4C) In contrast, the similar SerfiAla mutation in Chimera seemed not to influence the intracellular distribution of Chimera (see the difference between panels and in Fig 4C) These results indicate that the RK-rich region, domain 3B of SIK1, plays an important role in the nuclear localization of SIK1, but not for domain 3B of SIK2 Although several mutants, such as D573–585 (Fig 2A), I607A/L610A (Fig 3A), D586–612 + S577A (Fig 3B), Chimera + S577A (Fig 4C) and Chimera + S587A (Fig 4C), did not give unequivocal results as to the intracellular localization as well as the ACTH-dependent Ó FEBS 2004 Cytoplasmic SIK1 represses CREB (Eur J Biochem 271) 4313 A Fig Effect of alteration of the RK-rich region on the intracellular distribution of salt-inducible kinase (SIK1) (A) Effect of site-directed mutagenesis in the RK-rich region on the intracellular distribution of SIK1 Basic and hydrophobic residues, indicated by underlines and asterisks, respectively, were mutated to Ala The intracellular distribution of mutant SIKs was investigated as detailed in the legend to Fig (B) The RK-rich region (586–612) was replaced with a nuclear localization signal (NLS) of T-antigen or with a nuclear export signal (NES) of the Rev protein To disrupt the nuclear export, mutation S577A was introduced into wild-type SIK1 and SIK1(D586–612) These mutants were expressed as GFP-fusion proteins, and their intracellular distribution was examined as detailed in the legend of Fig B intracellular translocation, we decided to investigate the relationship between the intracellular localization and CREB repression activity of SIK1 mutants Even SIK1 mutants present in the cytoplasm repress PKA-induced CRE activity As reported previously, SIK1(S577A) was retained in the nucleus, even after the activation of PKA, and its transcriptional repression activity was higher than wild-type SIK1, indicating that SIK1 present in the nucleus could repress CREB activity [28] We decided to test the transcriptional repression activity of SIK1(1–708), another mutant localizing exclusively in the nucleus (shown in Fig 1B) The SIK1(1–708) expression plasmid, pIRESSIK1(1–708), was co-introduced with the CRE–reporter construct into Y1 cells in the presence or absence of the PKA expression vector, and the SIK1-dependent repression of CRE activity was examined As expected, the extent of CRE repression by SIK1(1–708) was greater than that induced by wild-type SIK1 (Fig 5A) The protein kinase activity was required for SIK1(1–708) to exert this repression, because the repression was not seen by SIK1(K56M/ 1–708) We further tested the CRE-repression activities of a variety of other mutants, whose intracellular localizations were examined in Fig 3B To our surprise, all the mutants seemed to inhibit CRE activity more strongly than wild-type SIK1 (Fig 5B) SIK1(D586–612 + NES), which was localized exclusively in the cytoplasm (Fig 3B), could also repress CRE activity as strongly as the nuclear resident SIK1(S577A) These results suggest that the nuclear localization of SIK1 might not be a prerequisite for its CRE repression By using Gal4–CREB reporter systems, we previously demonstrated that SIK1 repressed PKA-induced CREB activation by acting on the b-ZIP domain of CREB [29], and the nuclear resident SIK1(S577A) repressed CREB more strongly than the wild-type SIK1 [28] Similar experiments were designed to test whether the b-ZIP domain of CREB was the target site for the repressive action of the cytoplasmic SIK1 As shown in the left panel of Fig 5C, the cytoplasmic SIK1(D586–612 + NES) and the nuclear resident SIK1(S577A) similarly repressed the full-length CREB-dependent reporter activity On the contrary, neither mutant repressed the reporter activities of b-ZIP-less CREB (the right panel of Fig 5C) The other cytoplasmic SIK1 mutants, such as SIK1(D586–612) and SIK1(D573–631), were also able to repress the full-length CREB-dependent reporter activity (data not shown) To verify the above results, the expression levels of exogenous mutant SIK1 protein and their kinase activity were examined (Fig 5D) The results showed no significant difference in their expression levels These results suggest that SIK1, when present in the cytoplasm, is able to repress the 4314 Y Katoh et al (Eur J Biochem 271) Ó FEBS 2004 A B C PKA-induced CREB-activation through the b-ZIP domain of CREB We also confirmed that the size of the tag (GFP or HA) did not influence the intracellular distribution of SIK1 and its mutants The intracellular distribution of HA-tagged SIK1 and its mutants, S577A (nucleus) or D586–612 + NES (cytoplasm), showed similar features to those of their GFP-tagged counterparts (Fig 3B) The RK-rich region and the corresponding region of SIK2 modulate the CRE-repression activity The chimeras produced from the two SIK isoforms were tested for their CRE repression activity in Y1 cells Chimera 1, localizing mainly in the cytoplasm (Fig 4C), repressed CRE activity to an extent similar to that of wild-type SIK1 (Fig 6A) On the other hand, Chimera 1, having an S577A mutation, was a strong repressor To our surprise, both Chimera and wild-type SIK2 elevated, not repressed, the PKA-dependent enhanced CRE activity (Fig 6B), whereas Chimera 2, having an S587A mutation, was a strong repressor Because we previously reported that wild-type SIK2 repressed, not elevated, CRE activity in 3T3-L1 cells [31], the experiments with Chimera and wild-type SIK were repeated by using 3T3-L1 cells Both Chimera and wild-type SIK2 repressed the CRE activity to a moderate extent in 3T3-L1 cells The kinase activities of SIKs were essential for their CRErepression activities, and some kinase-defective mutant SIKs [SIK1 (K56M) and SIK2 (K49M)] have been shown to influence the CRE activity in a dominant-negative Fig Difference between salt-inducible kinase (SIK1) and SIK2 with special reference to domain (A) Alignment of the primary sequence and the subcellular distribution of SIK1 (blue bar) and SIK2 (pink bar) Three highly conserved regions, domains 1–3, were depicted (B) Amino acid sequences of domain are shown The protein kinase A (PKA)dependent phosphorylation sites, Ser577 in SIK1 and Ser587 in SIK2, are indicated in bold The basic residues in domain 3B are indicated by underlines The similarity between SIK1 and SIK2 in domain 3A, the N-terminal half of domain 3, is higher than that in domain 3B, the C-terminal half (C) The intracellular distribution of chimeras in Y1 cells manner [31] To exclude the possibility that the enhancement of CRE activity by SIK2 in Y1 cells was a result of lower kinase activity, GST-tagged SIK1 and SIK2 were expressed in Y1 cells, purified using glutathione columns and subjected to an in vitro kinase assay The specific kinase activity of SIK2 in Y1 cells was similar to that of SIK1 Although we cannot presently discuss the molecular mechanism underlying the up-regulation of CRE activity by SIK2 in Y1 cells, the RK-rich region of SIK1, and the corresponding region of SIK2, may play a critical role in modulating the CREB-repression activity of SIKs Both nuclear and cytoplasmic SIK1s inhibited the ACTH-induced nuclear entry of TORC2 TORCs, ubiquitously expressed in a variety of cells, are CREB-specific co-activators, essential for both basal and cAMP-induced CREB activity [38,39] Recently, cAMPinduced nuclear import of TORC2 was found in insulinoma cells [40], suggesting that the nucleo-cytoplasmic shuttling of TORC2 was important for the regulation of the co-activation function of TORC2 We also showed that SIK2 phosphorylated TORC2 at Ser171 and that the phospho-TORC2 could not enter the nuclei in forskolinstimulated cells [40] These findings prompted us to examine whether or not the nuclear import of TORC2 could occur in the SIK1 mutant-expressing Y1 cells As shown in Fig 7, GFP-fused TORC2 was localized both in the nucleus and in the cytoplasm of resting Y1 cells, ACTH(–) When the cells were treated with ACTH, Ó FEBS 2004 A Cytoplasmic SIK1 represses CREB (Eur J Biochem 271) 4315 B D C Fig Both nuclear and cytoplasmic salt-inducible kinase (SIK1) mutants repress cAMP-response element (CRE)/CRE-binding protein (CREB) activities (A) The protein kinase A (PKA)-induced CRE activity, and its repression by C-terminal-deleted nuclear SIK1, DC(708), and its kinasedefective mutant, K56M/DC(708), were investigated by using Y1 cells Y1 cells (1 · 105/well) were transfected with SIK1 expression plasmid, CREluciferase reporter, PKA expression plasmid and pRL-SV40 (internal standard), as described in the Materials and methods After 15 h of incubation, cells were harvested for luciferase assay The specific transcriptional activities derived from the CRE were expressed as fold-expression of the reporter activity of the empty vector, pTAL Mean values and SD are indicated (n ¼ 4) (B) The CRE activity of the RK-rich region mutants and S577A mutants (0.1 or 0.3 lg of SIK1-expression plasmid was used), as given in Fig 3B, were examined as described above Mean values and SD are indicated (n ¼ 3) (C) The transactivation activities of full-length CREB [CREB (F): (left panel)] and basic leucine zipper domain (b-ZIP) minus CREB [CREB (S): (right panel)] were investigated by using the Gal4 DNA-binding domain-linked assay Cells were transformed with the Gal4 DNA-binding domain-linked CREB expression vectors, described above, the expression vectors for SIK1, and PKA and reporters (GAL4linked luciferase reporter pTAL-5x GAL4 and internal standard pRL-SV40) The specific transcriptional activities of CREB were expressed as foldexpression of the empty Gal4 vector, pM Mean values and SD are indicated (n ¼ 3) Grey bars indicate CREB activities in Y1 cells overexpressing kinase-defective SIK1s Cells were transformed with expression plasmids for haemagglutinin (HA)-tagged wild-type and mutant SIKs After 36 h of incubation, cells were lysed, and HA-tagged SIK protein was immunoprecipitated by using anti-HA-tag IgG and protein G–Sepharose, as described in the Materials and methods The aliquots of immunopurified SIK1 were subjected to Western blot analyses with anti-SIK1 IgG (upper panel) and in vitro kinase assays (lower panel) GST-Syntide2 was used for a substrate The results were representative of experiments carried out in duplicate ACTH(+), GFP-TORC2 was found mostly in the nucleus, indicating that the ACTH signalling induced the nuclear import of TORC2, resulting in a TORC2-dependent CREB activation When HA-tagged SIK1 was co-expressed with GFP-TORC2 in these cells, most GFP-TORC2 signals were localized in the cytoplasm In the ACTH-treated cells, TORC2 seemed to move into the nucleus, although the extent of the nuclear import seemed less than that in the SIK1-nonexpressing control cells (–) When either the nuclear resident mutant SIK1, S577A, or the cytoplasmic mutant SIK1, D586–612 + NES, was co-expressed, more TORC2 seemed to be retained in the cytoplasm, corroborating that these SIK1 mutants could constitutively repress CREB activity (Fig 5B) Discussion We reported previously that SIK1 could repress the CREB-mediated transcription activation in cultured cells, and the extent of CREB repression apparently correlated with the amount of SIK1 present in the nucleus [28] Based on the assumption that a certain region of the SIK1 4316 Y Katoh et al (Eur J Biochem 271) Fig Effect of chimeric salt-inducible kinases (SIKs) on cAMPresponse element (CRE)/CRE-binding protein (CREB) activities The CRE-repressing activities of SIK1 and chimera (A) and of SIK2 and chimera (B) were examined by using Y1 cells, as described in the legend to Fig To express SIK1 and SIK2, we used pIRES (B-E) plasmid and pTarget plasmid, respectively The means and SD values are indicated (n ¼ 3) peptide is responsible for the nuclear localization of SIK1 and that this region may play a crucial role in the regulation of the SIK1-mediated transcription repression, we first tried to identify a nuclear localization signal of SIK1 Second, by utilizing SIK1 mutants with a defective nuclear localization signal, we examined the relationship between the nuclear localization and the transcription repression activity of SIK1 The RK-rich region (586–612), containing nine basic residues, was shown to act as a nuclear localization signal (Figs 1–4) This region, however, was not typical of nuclear localization signals [34,35,41–45] The importance of the Ó FEBS 2004 basic residues in the RK-rich region for the nuclear localization of SIK1 was also demonstrated by using chimeras of SIK1 and SIK2 (Fig 4) Hence, domain 3B of SIK2, the region corresponding to the RK-rich region, has only four basic residues, and SIK2 was localized mainly in the cytoplasm On the other hand, the SIK2-derived chimera, in which domain 3B was replaced with the RK-rich region, accumulated in the nucleus Conversely, the SIK1-derived chimera, containing domain 3B of SIK2, was localized to a significant extent in the cytoplasm The RK-rich region contains several hydrophobic residues that intersperse in the peptide stretch, a feature typical of the nuclear export signal (L-X2,3-L-X1,2-L-X-L) (hydrophobic residues are shown in bold) [46–49] The experiments using SIK1 mutants with disrupted hydrophobic residues, especially those of SIK1(I607A/L610A), indicated the importance of these residues for the nuclear distribution of SIK1 Using a variety of SIK1 mutants localized in the cytoplasm, we next examined CRE/CREB-repression activity of these mutants The results indicated that the mutants, although localized mainly in the cytoplasm, could repress CRE-reporter activity more strongly than wild-type SIK1 (Fig 5) Moreover, SIK1(D586–612 + NES), SIK1 having its RK-rich region replaced with a strong nuclear export signal, was localized exclusively in the cytoplasm, and nonetheless it behaved as a strong CREB-repressor The extent of repression by SIK1(D586–612 + NES) was similar to that induced by the nuclear SIK1(S577A) The experiments using chimeras of SIK1 and SIK2 also supported no correlation between the intracellular distribution and the CREB-repressing activity of SIKs (Fig 6) Fig Salt-inducible kinase (SIK1) inhibits the nuclear translocation of TORC2 (transducer of regulated CREB activity) The effects of SIK1 and its mutants on the subcellular localization of green fluorescent protein (GFP)-TORC2 were investigated as described in the legend to Fig and in the Materials and methods An expression plasmid for GFP-TORC2 was co-transfected without (–) or with wild-type (WT) SIK1 or mutant SIKs (nuclear: S577A or cytoplasmic: D586-612 + NES) to Y1 cells, and cells were treated with (+) or without (–) adrenocorticotropic hormone (ACTH) for 30 Ó FEBS 2004 Cytoplasmic SIK1 represses CREB (Eur J Biochem 271) 4317 Many intracellular shuttling molecules that change their intracellular localizations under the influence of cellular metabolism play their distinct roles in the respective cellular compartments Some molecules, however, when forced to remain in only one compartment, behave similarly to when they are retained in the other compartment For example, serum and glucocorticoid-induced kinase (Sgk), is known to change its intracellular localization during the cell cycle in mammary tumour cells [50,51] When ectopically expressed, the wild-type Sgk was retained only in the cytoplasmic compartment and induced growth arrest of transformed cells On the other hand, a Sgk mutant with the SV40 T-antigen NLS at its C terminus was retained in the nucleus, but was also found to inhibit cell growth [51] FKBP12rapamycin-associated protein (FRAP; also called mTOR or RAF), another shuttling kinase, is involved in the regulation of translation initiation by activating p70 S6 kinase and phosphorylating eIF-4E-binding protein [52] When FRAP was restricted to the nucleus by adding an exogenous nuclear localization signal, the activation of p70 S6 kinase and the phosphorylation of eIF-4E-binding protein were enhanced In contrast, the addition of an exogenous nuclear export signal to FRAP resulted in the inhibition of FRAPdependent cascades A translational-initiation reporter assay, however, indicated that the forced retention of FRAP not only in the cytoplasm, but also in the nucleus, inhibited rapamycin-sensitive translational initiation [52] These examples suggest that, in these cases, the nucleo-cytoplasmic shuttling, rather than the intracellular distribution, may be important for regulating the cellular functions Some shuttling molecules involved in transcription regulation(s) have their intracellular localization signals overlapped with the regions involved in transcription regulation Smad proteins transduce transforming growth factor-b (TGF-b) family cytokine signals from the plasma membrane to the nucleus The disruption of an intrinsic nuclear localization signal, or a nuclear export signal of Smad proteins, resulted in the accumulation of Smads in the cytoplasm or nucleus, respectively [53] Because a domain having these signals is overlapped with regions regulating transcriptional activity [54] and accepting upstream signals [55], the disruption of these signals resulted in the same phenotype, the impaired transcription activity of Smads Similarly, an intrinsic nuclear localization signal of MAPKactivated protein kinase (MK5) was shown to overlap with a binding site for the upstream kinase p38 [56] Thus, it was proposed that importin, a receptor for the nuclear localization signal and p38 might compete for their binding sites in MK5, and, as the result, the nucleo-cytoplasmic shuttling and the activation of MK5 occurred simultaneously in a coupled manner Taken together, we conclude that SIK1, present in the cytoplasm, could well repress the CREB-mediated transcription Therefore, the SIK1-mediated CREB-repression may not occur through a direct physical interaction between SIK1 and the CREB-transcriptional machinery complex in the nucleus Then, what mechanism underlies the SIK1dependent repression? A possible answer to this question would be that one of CREB co-activators, that when present in the nucleus interacts with CREB and activates the CREB-dependent transcription, is itself a phosphorylationdependent shuttling molecule This co-activator could be Fig The regions important for the intracellular distribution and cAMP-response element-binding protein (CREB)-modulating activity of salt-inducible kinase (SIK1) The kinase domain is indicated as KD The region 567–585 may be important for nuclear export of SIK1 when Ser577 is phosphorylated The region 586–612 (RK-rich region) may act as the major nuclear import signal of SIK1 The combination of phospho-Ser577 and the intact structure of the RK-rich region is required for attenuating the CREB repression activity of the SIK1 kinase domain phosphorylated by SIK1, either in the nucleus or in the cytoplasm, and the phosphorylated co-activator would move out of the nucleus or be tethered to the cytoplasm We found that TORCs were qualified as such co-activators [34,35] TORCs were shown to bind to the b-ZIP domain of CREB, the binding being independent of the Ser133– phosphorylation of CREB, and activate CREB-mediated transcription On the other hand, SIK1 was shown to repress CREB activity via the b-ZIP domain but fail to directly phosphorylate CREB The close examination revealed that TORCs indeed have SIKs-phosphorylation motifs These findings prompted us to test the possibility that SIK1 might regulate the TORCs activity in a phosphorylation-dependent manner Thus, we have shown that SIK2, when bound to TORC2, phosphorylated and inhibited the PKA-induced nuclear entry of TORC2 in insulinoma cells [36], and, in this study, SIK1 inhibited the ACTH-induced nuclear import of GFP-TORC2 (Fig 7) The inhibition of nuclear entry of TORC2 occurred only in the case using SIK1 lacking the phosphorylatable Ser577 or domain 3B, and seemed to occur independently of the intracellular localization of SIK1 These results strongly indicate that TORCs are the phosphorylation targets of SIKs-mediated CREB repression Figure illustrates domains of SIK1, with special reference to their roles for determining the intracellular localization and CREB-modulating activity The RK-rich region (586–612) (domain 3B) may act as the major nuclear localization signal Because the PKA-dependent phosphorylation of Ser577 induced the translocation of SIK1 to the cytoplasm, the phospho-Ser577 in domain A seems to be a key regulator for the nuclear export of SIK1 As for the major determinant for CREB-repression activity, the intact kinase domain is important SIK1(S577A) strongly represses the CREB activation, indicating that the phosphorylation in domain A disrupts the CREB-repression activity of SIK1 The loss of the RK-rich domain, SIK1(D586–612), Ó FEBS 2004 4318 Y Katoh et al (Eur J Biochem 271) also enhances the CREB-repression activity of SIK1, indicating that the complete combination of phosphodomain 3A and intact domain 3B is important for the modulation of CREB-repression activities of SIK1 An intact structure of domain of SIK may regulate the interaction between SIK and TORC The precise mechanism of SIK-dependent CREB repression is now under investigation 14 15 16 Acknowledgements This research was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology and Ministry of Health, Labor and Welfare Japan, a grant ÔTechnology Research Grant Program in 03Õ from the New Energy and Industrial Technology Development Organization (NEDO) of Japan, and grants from the Tokyo Biochemical Research Foundation, the ONO Medical Research Foundation and the Suzuken Memorial Foundation References Brindle, P., Linke, S & Montminy, M (1993) Protein-kinaseA-dependent activator in transcription factor CREB reveals new role for CREM repressors Nature 364, 821–824 Quinn, P.G (1993) Distinct activation domains within cAMP response element-binding protein (CREB) mediate basal and cAMP-stimulated transcription J Biol Chem 268, 16999–17009 Mayr, B & Montminy, M (2001) Transcriptional regulation by the phosphorylation-dependent factor CREB Nat Rev Mol Cell Biol 2, 599–609 Gonzalez, G.A & Montminy, M.R (1989) Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133 Cell 59, 675–680 Boshart, M., Weih, F., Nichols, M & Schutz, G (1991) The tissue-specific extinguisher locus TSE1 encodes a regulatory subunit of cAMP-dependent protein kinase Cell 66, 849–859 Xing, J., Kornhauser, J.M., Xia, Z., Thiele, E.A & Greenberg, M.E (1998) Nerve growth factor activates extracellular signalregulated kinase and p38 mitogen-activated protein kinase pathways to stimulate CREB serine 133 phosphorylation Mol Cell Biol 18, 1946–1955 Arthur, J.S & Cohen, P (2000) MSK1 is required for CREB phosphorylation in response to mitogens in mouse embryonic stem cells FEBS Lett 482, 44–48 Xing, J., Ginty, D.D & Greenberg, M.E (1996) Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase Science 273, 959–963 Du, K & Montminy, M (1998) CREB is a regulatory target for the protein kinase Akt/PKB J Biol Chem 273, 32377–323779 10 Sun, P., Enslen, H., Myung, P.S & Maurer, R.A (1994) Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity Genes Dev 8, 2527–2539 11 Matthews, R.P., Guthrie, C.R., Wailes, L.M., Zhao, X., Means, A.R & McKnight, G.S (1994) Calcium/calmodulin-dependent protein kinase types II and IV differentially regulate CREBdependent gene expression Mol Cell Biol 14, 6107–6116 12 Shimomura, A., Ogawa, Y., Kitani, T., Fujisawa, H & Hagiwara, M (1996) Calmodulin-dependent protein kinase II potentiates transcriptional activation through activating transcription factor but not cAMP response element-binding protein J Biol Chem 271, 17957–17960 13 Wu, X & McMurray, C.T (2001) Calmodulin kinase II attenuation of gene transcription by preventing cAMP response 17 18 19 20 21 22 23 24 25 26 27 28 29 element-binding protein (CREB) dimerization and binding of the CREB-binding protein J Biol Chem 276, 1735–1741 Chrivia, J.C., Kwok, R.P., Lamb, N., Hagiwara, M., Montminy, M.R & Goodman, R.H (1993) Phosphorylated CREB binds specifically to the nuclear protein CBP Nature 365, 855–885 Kwok, R.P., Lundblad, J.R., Chrivia, J.C., Richards, J.P., Bachinger, H.P., Brennan, R.G., Roberts, S.G., Green, M.R & Goodman, R.H (1994) Nuclear protein CBP is a coactivator for the transcription factor CREB Nature 370, 223–226 Arias, J., Alberts, A.S., Brindle, P., Claret, F.X., Smeal, T., Karin, M., Feramisco, J & Montminy, M (1994) Activation of cAMP and mitogen responsive genes relies on a common nuclear factor Nature 370, 226–229 Lundblad, J.R., Kwok, R.P., Laurance, M.E., Harter, M.L & Goodman, R.H (1995) Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP Nature 374, 85–88 Silverman, M.A., Benard, O., Jaaro, H., Rattner, A., Citri, Y & Seger, R (1999) CPG16, a novel protein serine/threonine kinase downstream of cAMP-dependent protein kinase J Biol Chem 274, 2631–2636 Reddy, U.R., Basu, A., Bannerman, P., Ikegaki, N., Reddy, C.D & Pleasure, D (1999) ZPK inhibits PKA induced transcriptional activation by CREB and blocks retinoic acid induced neuronal differentiation Oncogene 18, 4474–4484 Wang, Z., Takemori, H., Halder, S.K., Nonaka, Y & Okamoto, M (1999) Cloning of a novel kinase (SIK) of the SNF1/AMPK family from high salt diet-treated rat adrenal FEBS Lett 453, 135–139 Feldman, J.D., Vician, L., Crispino, M., Hoe, W., Baudry, M & Herschman, H.R (2000) The salt-inducible kinase, SIK, is induced by depolarization in brain J Neurochem 74, 2227– 2238 Hardie, D.G & Carling, D (1997) The AMP-activated protein kinase – fuel gauge of the mammalian cell? Eur J Biochem 246, 259–273 Drewes, G., Ebneth, A., Preuss, U., Mandelkow, E.M & Mandelkow, E (1997) MARK, a novel family of protein kinases that phosphorylate microtubule-associated proteins and triggers microtubule disruption Cell 89, 297–308 Lanjuin, A & Sengupta, P (2002) Regulation of chemosensory receptor expression and sensory signaling by the KIN-29 Ser/Thr kinase Neuron 33, 369–381 da Silva Xavier, G., Leclerc, I., Varadi, A., Tsuboi, T., Moule, S.K & Rutter, G.A (2003) Role for AMP-activated protein kinase in glucose-stimulated insulin secretion and preproinsulin gene expression Biochem J 371, 761–774 Shaw, R.J., Kosmatka, M., Bardeesy, N., Hurley, R.L., Witters, L.A., DePinho, R.A & Cantley, L.C (2004) LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1 EMBO J 23, 833–843 Lin, X., Takemori, H., Katoh, Y., Doi, J., Horike, N., Makino, A., Nonaka, Y & Okamoto, M (2001) Salt-inducible kinase is involved in the ACTH/cAMP-dependent protein kinase signaling in Y1 mouse adrenocortical tumor cells Mol Endocrinol 15, 1264–1276 Takemori, H., Katoh, Y., Horike, N., Doi, J & Okamoto, M (2002) ACTH-induced nucleocytoplasmic translocation of saltinducible kinase Implication in the protein kinase A-activated gene transcription in mouse adrenocortical tumor cells J Biol Chem 277, 42334–42343 Doi, J., Takemori, H., Lin, X.-Z., Horike, N., Katoh, Y & Okamoto, M (2002) Salt-inducible kinase represses PKA-mediated activation of human cholesterol side chain cleavage cytochrome promoter through the CREB basic leucine zipper domain J Biol Chem 277, 15629–15637 Ó FEBS 2004 Cytoplasmic SIK1 represses CREB (Eur J Biochem 271) 4319 30 Takemori, H., Doi, J., Horike, N., Katoh, Y., Min, L., Lin, X.Z., Wang, Z.N., Muraoka, M & Okamoto, M (2003) Salt-inducible kinase-mediated regulation of steroidogenesis at the early stage of ACTH-stimulation J Steroid Biochem Mol Biol 85, 397–400 31 Horike, N., Takemori, H., Katoh, Y., Doi, J., Min, L., Asano, T., Sun, X.J., Yamamoto, H., Kasayama, S., Muraoka, M., Nonaka, Y & Okamoto, M (2003) Adipose-specific expression, phosphorylation of Ser794 in insulin receptor substrate-1, and activation in diabetic animals of salt-inducible kinase-2 J Biol Chem 278, 18440–18447 32 Gorlich, D (1998) Transport into and out of the cell nucleus EMBO J 17, 2721–2727 33 Nigg, E.A (1997) Nucleocytoplasmic transport: signals, mechanisms and regulation Nature 386, 779–787 34 Kalderon, D., Roberts, B.L., Richardson, W.D & Smith, A.E (1984) A short amino acid sequence able to specify nuclear location Cell 39, 499–509 35 Tiganis, T., Flint, A.J., Adam, S.A & Tonks, N.K (1997) Association of the T-cell protein tyrosine phosphatase with nuclear import factor p97 J Biol Chem 272, 21548–21557 36 Fischer, U., Huber, J., Boelens, W.C., Mattaj, I.W & Luhrmann, R (1995) The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs Cell 82, 475–483 37 Okamoto, M., Takemori, H & Katoh, Y (2004) Salt-inducible kinase in steroidogenesis and adipogenesis Trends Endocrinol Metab 15, 21–26 38 Conkright, M.D., Canettieri, G., Screaton, R., Guzman, E., Miraglia, L., Hogenesch, J.B & Montminy, M (2003) TORCs: transducers of regulated CREB activity Mol Cell 12, 413–423 39 Iourgenko, V., Zhang, W., Mickanin, C., Daly, I., Jiang, C., Hexham, J.M., Orth, A.P., Miraglia, L., Meltzer, J., Garza, D., Chirn, G.W., McWhinnie, E., Cohen, D., Skelton, J., Terry, R., Yu, Y., Bodian, D., Buxton, F.P., Zhu, J., Song, C & Labow, M.A (2003) Identification of a family of cAMP response elementbinding protein coactivators by genome-scale functional analysis in mammalian cells Proc Natl Acad Sci USA 100, 12147–12152 40 Screaton, R.A., Conkright, M.D., Katoh, Y., Best, J., Canettieri, G., Jeffries, S., Guzman, E., Niessen, S., Yates, J.R III, Takemori, H., Okamoto, M & Montminy, M.R (2004) The CREB Coactivator TORC2 Functions as a Calcium- and cAMP-Sensitive Coincidence Detector Cell 119, 61–74 41 Robbins, J., Dilworth, S.M., Laskey, R.A & Dingwall, C (1991) Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence Cell 64, 615–623 42 Siomi, H & Dreyfuss, G (1995) A nuclear localization domain in the hnRNP A1 protein J Cell Biol 129, 551–560 43 Jakel, S & Gorlich, D (1998) Importin beta, transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells EMBO J 17, 4491–4502 44 Mo, Y.Y., Wang, C & Beck, W.T (2000) A novel nuclear localization signal in human DNA topoisomerase I J Biol Chem 275, 41107–41113 45 Jans, D.A., Xiao, C.Y & Lam, M.H (2000) Nuclear targeting signal recognition: a key control point in nuclear transport? Bioessays 22, 532–544 46 Fukuda, M., Asano, S., Nakamura, T., Adachi, M., Yoshida, M., Yanagida, M & Nishida, E (1997) CRM1 is responsible for intracellular transport mediated by the nuclear export signal Nature 390, 308–311 47 Ducret, C., Maira, S.M., Dierich, A & Wasylyk, B (1999) The net repressor is regulated by nuclear export in response to anisomycin, UV, and heat shock Mol Cell Biol 19, 7076–7087 48 Graves, P.R., Lovly, C.M., Uy, G.L & Piwnica Worms, H (2001) Localization of human Cdc25C is regulated both by 49 50 51 52 53 54 55 56 nuclear export and 14-3-3 protein binding Oncogene 20, 1839– 1851 Kuersten, S., Ohno, M & Mattaj, I.W (2001) Nucleocytoplasmic transport: Ran, beta and beyond Trends Cell Biol 11, 497–503 Webster, M.K., Goya, L & Firestone, G.L (1993) Immediateearly transcriptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase J Biol Chem 268, 11482–11485 Buse, P., Tran, S.H., Luther, E., Phu, P.T., Aponte, G.W & Firestone, G.L (1999) Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoidinducible protein kinase, Sgk, in mammary tumor cells A novel convergence point of anti-proliferative and proliferative cell signaling pathways J Biol Chem 274, 7253–7263 Kim, J.E & Chen, J (2000) Cytoplasmic-nuclear shuttling of FKBP12-rapamycin-associated protein is involved in rapamycinsensitive signaling and translation initiation Proc Natl Acad Sci USA 97, 14340–14345 Xiao, Z., Watson, N., Rodriguez, C & Lodish, H.F (2001) Nucleocytoplasmic shuttling of Smad1 conferred by its nuclear localization and nuclear export signals J Biol Chem 276, 39404– 39410 Xiao, Z., Latek, R & Lodish, H.F (2003) An extended bipartite nuclear localization signal in Smad4 is required for its nuclear import and transcriptional activity Oncogene 22, 1057–1069 Xiao, Z., Brownawell, A.M., Macara, I.G & Lodish, H.F (2003) A novel export signal in Smad1 is essential for its signaling activity J Biol Chem 278, 34245–34252 Seternes, O.M., Johansen, B., Hegge, B., Johannessen, M., Keyse, S.M & Moens, U (2002) Both binding and activation of p38 mitogen-activated protein kinase (MAPK) play essential roles in regulation of the nucleocytoplasmic distribution of MAPKactivated protein kinase by cellular stress Mol Cell Biol 22, 6931–6945 Supplementary material The following material is available from http://www blackwellpublishing.com/products/journals/suppmat/EJB/ EJB4372/EJB4372sm.htm Fig S1 Immunocytochemical analysis of the intracellular distribution of HA-SIK1 and HA-SIK1 mutants (S577A, D586–612 + NES) in resting and ACTH treated Y1 cells After fixation with 4% paraformaldehyde, cells were incubated with rat anti-HA monoclonal antibody followed by FITC-labeled goat anti-rat IgG Cells expressing HA-SIK1 were observed by fluorescent microscopy (green) Nuclear staining was indicated by DAPI (blue) Fig S2 (A) 3T3-L1 cells were used for CRE-reporter assay as described in Fig (B) The modulation of CRE-reporter activities by various kinase defective SIK1 (left) and SIK2 (right) were examined as described in the legends for Fig Means ± SD are indicated (n ¼ 3) (C) The level of kinase activity of SIK2 in Y1 cells was almost same as that of SIK1 Y1 cells (5 · 105) were transformed with lg of pEBG-SIK1 or pEBG-SIK2 using 10 ll of Lipofect AMINE 2000 After the 36 h-incubation, GST-tagged SIK protein was purified using a glutathione-sepharose column (CP) The aliquots of GST-SIK protein were subjected to western blot analyses (WB) with anti-GST IgG (lower panel) and in vitro kinase assays using [32P]ATP[cP] and GST-Syntide2 as a substrate (upper panel) The results are representatives of experiments performed in duplicate  ... important for the intracellular distribution and cAMP- response element-binding protein (CREB)-modulating activity of salt-inducible kinase (SIK1) The kinase domain is indicated as KD The region 567–585... another shuttling kinase, is involved in the regulation of translation initiation by activating p70 S6 kinase and phosphorylating eIF-4E-binding protein [52] When FRAP was restricted to the nucleus. .. attenuating the CREB repression activity of the SIK1 kinase domain phosphorylated by SIK1, either in the nucleus or in the cytoplasm, and the phosphorylated co-activator would move out of the nucleus