0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

Báo cáo khoa học:

Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

... creased because of the addition of the link nodes in the grammar. 2 Constraint Grammar Dependency Instead of using context-free grammars, we are using a natural language framework based ... Research in the Development of a Spoken Language Understanding System using PARSEC* Carla B. Zoltowski School of Electrical Engineering Purdue University West Lafayette, IN 47907 February ... categories) and allowing the word to modify all the remaining words in the sentence or no words at all. Each of the arcs in the network has associated with it a matrix whose row and column indices are...
  • 2
  • 359
  • 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

... According to the sequenceobtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated averagemolecular ... xdhA gene(ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene(gcccagtacctacaagattc). Localization of xdhAB genes on the C. acidovorans plasmid was established using the AlkPhosDirect System ... was performedusing the QIAprep Spin Miniprepkit (Qiagen Inc., Valencia, CA, USA). All DNA manipula-tions were carried out using standard protocols [24].LASERGENEsoftware (DNAstar Inc., Madison,...
  • 11
  • 584
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx

... execute commands. The main functions of ATLAS are the following : - Editing and updating of indexing charts : compi- lation of an external form of the chart, and modification of the internal form ... may be represented by associating questions to each node and the possible answers to the arcs coming from a node ; the leaves of the tree bear the name of the code and an example. A language ... Translation (CAT) application. Previously, linguists used indexing manuals when adding new words to dictionaries. These manuals contained indexing charts, sorts of graphs enabling the search...
  • 4
  • 404
  • 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... CH3-4-aminobutyrateand not 4-aminobutyrate was the substrate of the AOand thus both MABO and AO have the same substrateled us to postulate two pathways for the catabolism of CH3-4-aminobutyrate ... pro-duction in the assay was determined with the additions as indicat-ed. The presence of AO, SsaDH and CH3-4-aminobutyrate assubstrate were required for maximal activity. In the absence of AOthere ... [14,15]. The amino group of 4-aminobutyrate, the second reaction product in thispathway, may be transaminated to a- ketoglutarate and the remaining succinic semialdehyde may be oxidizedto succinate...
  • 9
  • 524
  • 0
Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

... explained by changes in translation ormaturation of the protein. An increase was alsoobserved in the rate of degradation of the remainingmutant protein (20% left of the protein) vs. the wildtype ... for the ligand-activated and nonactivated Gaq. Adding newmedia containing 10 lm carbachol every 30 min during the chase period did not have any effect on the rate of degradation either (data ... of Ga16and Gaqsubunits. Therefore the lack of change in the rate of degradation cannot be due to lack of receptor-activa-tion of the alpha subunits.Given that the activation of G proteins...
  • 13
  • 465
  • 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

... in Table 2, there was a markeddifference in the total cell ATP synthesis as well asmitochondrial respiration-coupled ATP synthesis in macrophages and PC12 cells. The rate of ATP synthesis in ... migration, the slowmigrating complex may be a dimmer and the fastermigrating complex migrating with an apparent molecularmass of 200 kDa may be the monomeric form. It isinteresting that the ... Subbuswamy K. Prabu1,*, Cynthia M. Otto2and Narayan G. Avadhani11Department of Animal Biology and2Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania,Philadelphia,...
  • 9
  • 554
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Conceptual Coherence in the Generation of Referring Expressions" potx

... is a function of the information gained by giving a joint descrip-tion of a and b in terms of what they have in com-mon, compared to describing a and b separately. The relevant data in the ... similar).We use the information contained in the SketchEngine database1(Kilgarriff, 2003), a largescale implementation of Lin’s theory basedon the BNC, which contains grammatical triples in the ... pictures ar-ranged in an array on a screen. Of the three targets (a, b, c), c was always an object whose name in the norms was dissimilar to that of a and b. The semantic similarity of (nouns denoting)...
  • 8
  • 414
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Case Revisited: In the Shadow of Automatic Processing of Machine-Readable Dictionaries" ppt

... classifications based on semantic and pragmatic codes in LDOCE, and examples in LDOCE can help to obtain such theories. 3. Formation of the context layer: the unification of the base layer ... supported in paxt by CRL. Some of the ideas were developed during my stay in CS/Fudan and CMT/CMU. 1The words passine/'acti~e are used to indicate dif- ferent levels of activeness. In what ... Cases such as agent and instrument have somewhat different meanings than the conventional ones. We use them just for referring to a group of phenomena which are related to their names. are...
  • 2
  • 247
  • 0
Báo cáo khoa học: Calpain involvement in the remodeling of cytoskeletal anchorage complexes potx

Báo cáo khoa học: Calpain involvement in the remodeling of cytoskeletal anchorage complexes potx

... Wehave found that this actin-binding protein is a newsubstrate of calpain 1 separating the core domain,able to bind actin and the N-terminal domain whichsupports the protein regulation (calcium ... signal-regulated kinase and activation of the protease in the absence of calcium [34,35]. On the other hand, calpain inactivation can be achieved whencalpain 2 is phosphorylated by protein kinase A [36].Activation ... [36].Activation of the protease activity, as followed byFAK cleavage and FA disruption, can also be associ-ated with the degradation of the specific inhibitor of calpain, calpastatin. Indeed, Carragher...
  • 12
  • 432
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Spatial Lexicalization in the Translation of Prepositional Phrases" pot

... language (SL) has more that one translation into the target language (TL). Lexical gaps occur when a word in one language can not be trans- lated directly into another language. This latter prob- ... some as the key translation problem, (Kameyama et al., 1991). A case in point is the translation of prepositional phrases (PP). The following entry for the translations into Spanish of the ... is argued in (Talmy, 1985) that languages differ in the type of information they systematically encode in lexical units. That is, languages exhibit distinct lexical- ization patterns. For instance,...
  • 3
  • 309
  • 0

Xem thêm

Từ khóa: the development of a developer facing telemetry system at biowarebáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ